Incidental Mutation 'R6102:Tmem176b'
ID485300
Institutional Source Beutler Lab
Gene Symbol Tmem176b
Ensembl Gene ENSMUSG00000029810
Gene Nametransmembrane protein 176B
Synonyms1810009M01Rik, Clast1, Lr8
MMRRC Submission 044252-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R6102 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location48833818-48841496 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48835934 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 109 (V109A)
Ref Sequence ENSEMBL: ENSMUSP00000144949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101429] [ENSMUST00000164733] [ENSMUST00000166247] [ENSMUST00000203229] [ENSMUST00000203265] [ENSMUST00000203355] [ENSMUST00000203501] [ENSMUST00000204073] [ENSMUST00000204400] [ENSMUST00000204783] [ENSMUST00000205147] [ENSMUST00000205159]
Predicted Effect probably benign
Transcript: ENSMUST00000101429
AA Change: V109A

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000098972
Gene: ENSMUSG00000029810
AA Change: V109A

DomainStartEndE-ValueType
Pfam:CD20 60 224 5.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164733
AA Change: V109A

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128705
Gene: ENSMUSG00000029810
AA Change: V109A

DomainStartEndE-ValueType
Pfam:CD20 60 224 5.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166247
AA Change: V109A

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000131064
Gene: ENSMUSG00000029810
AA Change: V109A

DomainStartEndE-ValueType
Pfam:CD20 60 224 7.6e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203229
AA Change: V109A

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000144865
Gene: ENSMUSG00000029810
AA Change: V109A

DomainStartEndE-ValueType
Pfam:CD20 60 195 2.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203265
AA Change: V109A

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000144869
Gene: ENSMUSG00000029810
AA Change: V109A

DomainStartEndE-ValueType
Pfam:CD20 60 194 2.9e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203355
AA Change: V109A

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000145395
Gene: ENSMUSG00000029810
AA Change: V109A

DomainStartEndE-ValueType
Pfam:CD20 60 224 7.6e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203501
AA Change: V109A

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000144742
Gene: ENSMUSG00000029810
AA Change: V109A

DomainStartEndE-ValueType
Pfam:CD20 60 170 3.6e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203618
Predicted Effect probably benign
Transcript: ENSMUST00000204073
AA Change: V109A

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000144864
Gene: ENSMUSG00000029810
AA Change: V109A

DomainStartEndE-ValueType
Pfam:CD20 60 224 7.6e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204400
Predicted Effect probably benign
Transcript: ENSMUST00000204783
SMART Domains Protein: ENSMUSP00000144810
Gene: ENSMUSG00000029810

DomainStartEndE-ValueType
Pfam:CD20 1 58 1.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205147
AA Change: V109A

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000145235
Gene: ENSMUSG00000029810
AA Change: V109A

DomainStartEndE-ValueType
Pfam:CD20 60 195 2.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205159
AA Change: V109A

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000144949
Gene: ENSMUSG00000029810
AA Change: V109A

DomainStartEndE-ValueType
Pfam:CD20 60 196 1.2e-35 PFAM
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 97% (65/67)
MGI Phenotype PHENOTYPE: Most mice homozygous for a knock-out allele exhibit severe sporadic ataxia and a small cerebellum associated with abnormal cerebellar lobulation, loss of the internal granule cell layer, poor formation of the external germinal layer, and disorganized Purkinje cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e A G 11: 70,320,023 I290T possibly damaging Het
Apeh T A 9: 108,086,439 D559V probably damaging Het
Aspm T A 1: 139,477,459 Y1361* probably null Het
Atad5 G T 11: 80,111,572 probably null Het
Ccr4 C T 9: 114,496,493 probably null Het
Clasrp G A 7: 19,586,468 probably benign Het
Cldn23 A G 8: 35,825,551 M261T probably benign Het
Cmya5 T C 13: 93,094,231 M1450V probably benign Het
Cyp4v3 T A 8: 45,320,160 E202V probably damaging Het
Dnah7a A T 1: 53,559,140 V1412E probably benign Het
Dnah9 A G 11: 65,990,516 S2578P probably damaging Het
Dsc2 T A 18: 20,047,108 Y196F probably benign Het
Exoc1 T C 5: 76,537,779 S113P probably damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Frs3 C T 17: 47,702,671 H173Y probably damaging Het
Ginm1 G T 10: 7,768,496 T323K probably benign Het
Golgb1 T C 16: 36,912,865 S825P probably damaging Het
Hs3st3b1 A T 11: 63,921,855 C11* probably null Het
Ighv3-3 G C 12: 114,196,460 A110G possibly damaging Het
Igkv6-20 G A 6: 70,335,869 H107Y probably benign Het
Kcnj16 A G 11: 111,025,577 E355G probably benign Het
Lig4 C T 8: 9,972,872 G303S probably damaging Het
Map1b A C 13: 99,425,873 V2443G unknown Het
Map3k6 T C 4: 133,247,131 probably null Het
Mmp13 A G 9: 7,276,688 Q261R probably benign Het
Mphosph9 T A 5: 124,297,709 I554F possibly damaging Het
Mrgpra3 A T 7: 47,590,149 F10I possibly damaging Het
Ms4a18 G A 19: 11,013,523 T69I probably benign Het
Mtmr3 T C 11: 4,487,673 N927S probably damaging Het
Necab1 T A 4: 14,989,211 Q188L probably benign Het
Nfatc2 A G 2: 168,519,507 probably benign Het
Olfr152 T C 2: 87,782,848 F103L probably damaging Het
Olfr495 T C 7: 108,395,284 S55P probably damaging Het
Olfr854 T C 9: 19,567,022 M121V possibly damaging Het
Paip2b A C 6: 83,808,846 V134G possibly damaging Het
Pax3 T C 1: 78,132,347 T225A probably damaging Het
Pbx1 C A 1: 168,183,565 A298S probably benign Het
Pcdhac2 A T 18: 37,146,282 K772* probably null Het
Pcsk4 A T 10: 80,325,817 Y163* probably null Het
Plcd3 A G 11: 103,080,644 V58A probably damaging Het
Plek2 T A 12: 78,900,093 T57S possibly damaging Het
Plscr2 C T 9: 92,287,668 T57I probably benign Het
Ppp2r5b A G 19: 6,234,738 S32P probably benign Het
Ppp3r2 C T 4: 49,682,022 probably benign Het
Psme4 T A 11: 30,865,567 L1693H probably damaging Het
Rrbp1 T A 2: 143,988,393 Q618L probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Serpina3b A T 12: 104,134,169 T337S probably benign Het
Slc18a2 T C 19: 59,293,878 Y506H probably benign Het
Slc9a9 A G 9: 94,936,429 Y292C probably benign Het
Spta1 T C 1: 174,224,520 V1840A probably benign Het
Ssb T C 2: 69,871,208 *416Q probably null Het
Strada A G 11: 106,168,436 V209A probably benign Het
Tbc1d31 A T 15: 57,936,093 D225V probably damaging Het
Tgm4 T C 9: 123,056,535 F381L probably benign Het
Tmem120b T A 5: 123,115,144 Y203N probably damaging Het
Tnfrsf11a C A 1: 105,819,946 L201M possibly damaging Het
Ttn C A 2: 76,974,350 probably null Het
Tubb2a T C 13: 34,075,343 I155V probably benign Het
Vmn1r5 A G 6: 56,986,114 D258G probably damaging Het
Vmn2r121 T C X: 124,133,575 T120A probably benign Het
Vmn2r19 A T 6: 123,329,948 I472F probably damaging Het
Vwa3a A G 7: 120,776,138 probably null Het
Zfp273 A G 13: 67,822,347 Y5C probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp825 A G 13: 74,480,653 L248P probably damaging Het
Other mutations in Tmem176b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Tmem176b APN 6 48834070 missense possibly damaging 0.79
IGL02374:Tmem176b APN 6 48834626 missense possibly damaging 0.60
IGL03027:Tmem176b APN 6 48835639 missense probably damaging 1.00
IGL03134:Tmem176b UTSW 6 48838353 missense probably benign 0.00
R1634:Tmem176b UTSW 6 48834566 missense probably damaging 1.00
R1920:Tmem176b UTSW 6 48838204 missense possibly damaging 0.70
R2008:Tmem176b UTSW 6 48835449 missense probably damaging 0.97
R2056:Tmem176b UTSW 6 48836333 missense probably damaging 0.97
R2057:Tmem176b UTSW 6 48836333 missense probably damaging 0.97
R2059:Tmem176b UTSW 6 48836333 missense probably damaging 0.97
R5099:Tmem176b UTSW 6 48834529 missense probably benign
R5484:Tmem176b UTSW 6 48834533 missense probably benign 0.01
R5623:Tmem176b UTSW 6 48834070 missense probably benign 0.14
R6413:Tmem176b UTSW 6 48838332 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACTCTGCTCATCAGTGGCAG -3'
(R):5'- CAAGTGTCGGCTTGTATGC -3'

Sequencing Primer
(F):5'- CTCATCAGTGGCAGAGTCACAG -3'
(R):5'- ATGCTGCTTGCCTTTGGAAC -3'
Posted On2017-08-16