Incidental Mutation 'R6102:Clasrp'
ID485305
Institutional Source Beutler Lab
Gene Symbol Clasrp
Ensembl Gene ENSMUSG00000061028
Gene NameCLK4-associating serine/arginine rich protein
SynonymsSrsf16, Sfrs16, SWAP2
MMRRC Submission 044252-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6102 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location19581035-19604486 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) G to A at 19586468 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086041] [ENSMUST00000207524] [ENSMUST00000207663] [ENSMUST00000207907] [ENSMUST00000208068]
Predicted Effect unknown
Transcript: ENSMUST00000086041
AA Change: R422C
SMART Domains Protein: ENSMUSP00000083205
Gene: ENSMUSG00000061028
AA Change: R422C

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
DRY_EERY 39 171 1.28e-64 SMART
low complexity region 172 212 N/A INTRINSIC
low complexity region 241 260 N/A INTRINSIC
low complexity region 263 283 N/A INTRINSIC
low complexity region 302 324 N/A INTRINSIC
low complexity region 339 368 N/A INTRINSIC
low complexity region 372 446 N/A INTRINSIC
low complexity region 453 476 N/A INTRINSIC
low complexity region 480 532 N/A INTRINSIC
coiled coil region 574 630 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207447
Predicted Effect probably benign
Transcript: ENSMUST00000207524
Predicted Effect probably benign
Transcript: ENSMUST00000207663
Predicted Effect unknown
Transcript: ENSMUST00000207907
AA Change: R422C
Predicted Effect unknown
Transcript: ENSMUST00000208068
AA Change: R422C
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208716
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209059
Meta Mutation Damage Score 0.222 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: The protein encoded by this gene contains serine/arginine (SR) dipeptide repeat domains, and is thought to be involved in the regulation of alternative splicing. This protein is thought to interact with, and be phosphorylated by, Clk4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e A G 11: 70,320,023 I290T possibly damaging Het
Apeh T A 9: 108,086,439 D559V probably damaging Het
Aspm T A 1: 139,477,459 Y1361* probably null Het
Atad5 G T 11: 80,111,572 probably null Het
Ccr4 C T 9: 114,496,493 probably null Het
Cldn23 A G 8: 35,825,551 M261T probably benign Het
Cmya5 T C 13: 93,094,231 M1450V probably benign Het
Cyp4v3 T A 8: 45,320,160 E202V probably damaging Het
Dnah7a A T 1: 53,559,140 V1412E probably benign Het
Dnah9 A G 11: 65,990,516 S2578P probably damaging Het
Dsc2 T A 18: 20,047,108 Y196F probably benign Het
Exoc1 T C 5: 76,537,779 S113P probably damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Frs3 C T 17: 47,702,671 H173Y probably damaging Het
Ginm1 G T 10: 7,768,496 T323K probably benign Het
Golgb1 T C 16: 36,912,865 S825P probably damaging Het
Hs3st3b1 A T 11: 63,921,855 C11* probably null Het
Ighv3-3 G C 12: 114,196,460 A110G possibly damaging Het
Igkv6-20 G A 6: 70,335,869 H107Y probably benign Het
Kcnj16 A G 11: 111,025,577 E355G probably benign Het
Lig4 C T 8: 9,972,872 G303S probably damaging Het
Map1b A C 13: 99,425,873 V2443G unknown Het
Map3k6 T C 4: 133,247,131 probably null Het
Mmp13 A G 9: 7,276,688 Q261R probably benign Het
Mphosph9 T A 5: 124,297,709 I554F possibly damaging Het
Mrgpra3 A T 7: 47,590,149 F10I possibly damaging Het
Ms4a18 G A 19: 11,013,523 T69I probably benign Het
Mtmr3 T C 11: 4,487,673 N927S probably damaging Het
Necab1 T A 4: 14,989,211 Q188L probably benign Het
Nfatc2 A G 2: 168,519,507 probably benign Het
Olfr152 T C 2: 87,782,848 F103L probably damaging Het
Olfr495 T C 7: 108,395,284 S55P probably damaging Het
Olfr854 T C 9: 19,567,022 M121V possibly damaging Het
Paip2b A C 6: 83,808,846 V134G possibly damaging Het
Pax3 T C 1: 78,132,347 T225A probably damaging Het
Pbx1 C A 1: 168,183,565 A298S probably benign Het
Pcdhac2 A T 18: 37,146,282 K772* probably null Het
Pcsk4 A T 10: 80,325,817 Y163* probably null Het
Plcd3 A G 11: 103,080,644 V58A probably damaging Het
Plek2 T A 12: 78,900,093 T57S possibly damaging Het
Plscr2 C T 9: 92,287,668 T57I probably benign Het
Ppp2r5b A G 19: 6,234,738 S32P probably benign Het
Ppp3r2 C T 4: 49,682,022 probably benign Het
Psme4 T A 11: 30,865,567 L1693H probably damaging Het
Rrbp1 T A 2: 143,988,393 Q618L probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Serpina3b A T 12: 104,134,169 T337S probably benign Het
Slc18a2 T C 19: 59,293,878 Y506H probably benign Het
Slc9a9 A G 9: 94,936,429 Y292C probably benign Het
Spta1 T C 1: 174,224,520 V1840A probably benign Het
Ssb T C 2: 69,871,208 *416Q probably null Het
Strada A G 11: 106,168,436 V209A probably benign Het
Tbc1d31 A T 15: 57,936,093 D225V probably damaging Het
Tgm4 T C 9: 123,056,535 F381L probably benign Het
Tmem120b T A 5: 123,115,144 Y203N probably damaging Het
Tmem176b A G 6: 48,835,934 V109A probably benign Het
Tnfrsf11a C A 1: 105,819,946 L201M possibly damaging Het
Ttn C A 2: 76,974,350 probably null Het
Tubb2a T C 13: 34,075,343 I155V probably benign Het
Vmn1r5 A G 6: 56,986,114 D258G probably damaging Het
Vmn2r121 T C X: 124,133,575 T120A probably benign Het
Vmn2r19 A T 6: 123,329,948 I472F probably damaging Het
Vwa3a A G 7: 120,776,138 probably null Het
Zfp273 A G 13: 67,822,347 Y5C probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp825 A G 13: 74,480,653 L248P probably damaging Het
Other mutations in Clasrp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02394:Clasrp APN 7 19603254 missense probably damaging 1.00
clarissa UTSW 7 19590248 missense possibly damaging 0.82
suet UTSW 7 19586468 utr 3 prime probably benign
R0518:Clasrp UTSW 7 19588603 missense probably benign 0.32
R0519:Clasrp UTSW 7 19584164 utr 3 prime probably benign
R0521:Clasrp UTSW 7 19588603 missense probably benign 0.32
R0626:Clasrp UTSW 7 19584493 utr 3 prime probably benign
R0826:Clasrp UTSW 7 19584301 utr 3 prime probably benign
R1918:Clasrp UTSW 7 19585263 nonsense probably null
R2044:Clasrp UTSW 7 19586715 utr 3 prime probably benign
R2256:Clasrp UTSW 7 19586585 utr 3 prime probably benign
R2257:Clasrp UTSW 7 19586585 utr 3 prime probably benign
R2870:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R2870:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R2871:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R2871:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R2940:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R3408:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R3691:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R4168:Clasrp UTSW 7 19581154 unclassified probably benign
R4496:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R4505:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R4507:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R4572:Clasrp UTSW 7 19584464 splice site probably null
R4753:Clasrp UTSW 7 19594940 missense probably damaging 1.00
R4871:Clasrp UTSW 7 19590248 missense possibly damaging 0.82
R4938:Clasrp UTSW 7 19584778 splice site probably null
R5538:Clasrp UTSW 7 19584782 utr 3 prime probably benign
R5582:Clasrp UTSW 7 19586856 missense probably damaging 0.97
R5615:Clasrp UTSW 7 19586447 utr 3 prime probably benign
R5794:Clasrp UTSW 7 19591109 missense probably damaging 0.99
R5944:Clasrp UTSW 7 19594506 missense probably damaging 1.00
R6171:Clasrp UTSW 7 19584822 splice site probably benign
R6485:Clasrp UTSW 7 19586369 utr 3 prime probably benign
R6600:Clasrp UTSW 7 19590282 nonsense probably null
R7383:Clasrp UTSW 7 19585273 missense unknown
Predicted Primers PCR Primer
(F):5'- GTGCTTCCCAAGAGAAGAGG -3'
(R):5'- TCTAGGACAGTGTCGCTCAC -3'

Sequencing Primer
(F):5'- CTTCCCAAGAGAAGAGGGGCTG -3'
(R):5'- GTGTCGCTCACAAACCCTG -3'
Posted On2017-08-16