Incidental Mutation 'R6102:Mmp13'
ID485313
Institutional Source Beutler Lab
Gene Symbol Mmp13
Ensembl Gene ENSMUSG00000050578
Gene Namematrix metallopeptidase 13
SynonymsMMP-13, interstitial collagenase, Clg, Mmp1, Collagenase-3, collagenase-1
MMRRC Submission 044252-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R6102 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location7272514-7283331 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7276688 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 261 (Q261R)
Ref Sequence ENSEMBL: ENSMUSP00000015394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015394]
PDB Structure
STRUCTURE OF RECOMBINANT MOUSE COLLAGENASE-3 (MMP-13) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000015394
AA Change: Q261R

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000015394
Gene: ENSMUSG00000050578
AA Change: Q261R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:PG_binding_1 33 92 5.3e-13 PFAM
ZnMc 110 269 3.76e-59 SMART
HX 291 333 9.62e-8 SMART
HX 335 378 9.91e-10 SMART
HX 383 430 2.52e-11 SMART
HX 432 472 1.81e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family that plays a role in wound healing, skeletal development and bone remodeling. The encoded protein is activated by the removal of an N-terminal activation peptide to generate a zinc-dependent endopeptidase enzyme that can cleave various native collagens, including types I - IV, X and XIV. Mice lacking the encoded protein display profound defects in growth plate cartilage as well as a delay in the endochondral bone development. Lack of the encoded protein also impairs the wound healing process due to reduced keratinocyte migration and vascular density at the wound site. This gene is located in a cluster of other matrix metalloproteinase genes on chromosome 9. [provided by RefSeq, Jun 2015]
PHENOTYPE: Homozygous null mice display increased width of hypertrophic chondrocyte zone and increased trabecular bone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e A G 11: 70,320,023 I290T possibly damaging Het
Apeh T A 9: 108,086,439 D559V probably damaging Het
Aspm T A 1: 139,477,459 Y1361* probably null Het
Atad5 G T 11: 80,111,572 probably null Het
Ccr4 C T 9: 114,496,493 probably null Het
Clasrp G A 7: 19,586,468 probably benign Het
Cldn23 A G 8: 35,825,551 M261T probably benign Het
Cmya5 T C 13: 93,094,231 M1450V probably benign Het
Cyp4v3 T A 8: 45,320,160 E202V probably damaging Het
Dnah7a A T 1: 53,559,140 V1412E probably benign Het
Dnah9 A G 11: 65,990,516 S2578P probably damaging Het
Dsc2 T A 18: 20,047,108 Y196F probably benign Het
Exoc1 T C 5: 76,537,779 S113P probably damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Frs3 C T 17: 47,702,671 H173Y probably damaging Het
Ginm1 G T 10: 7,768,496 T323K probably benign Het
Golgb1 T C 16: 36,912,865 S825P probably damaging Het
Hs3st3b1 A T 11: 63,921,855 C11* probably null Het
Ighv3-3 G C 12: 114,196,460 A110G possibly damaging Het
Igkv6-20 G A 6: 70,335,869 H107Y probably benign Het
Kcnj16 A G 11: 111,025,577 E355G probably benign Het
Lig4 C T 8: 9,972,872 G303S probably damaging Het
Map1b A C 13: 99,425,873 V2443G unknown Het
Map3k6 T C 4: 133,247,131 probably null Het
Mphosph9 T A 5: 124,297,709 I554F possibly damaging Het
Mrgpra3 A T 7: 47,590,149 F10I possibly damaging Het
Ms4a18 G A 19: 11,013,523 T69I probably benign Het
Mtmr3 T C 11: 4,487,673 N927S probably damaging Het
Necab1 T A 4: 14,989,211 Q188L probably benign Het
Nfatc2 A G 2: 168,519,507 probably benign Het
Olfr152 T C 2: 87,782,848 F103L probably damaging Het
Olfr495 T C 7: 108,395,284 S55P probably damaging Het
Olfr854 T C 9: 19,567,022 M121V possibly damaging Het
Paip2b A C 6: 83,808,846 V134G possibly damaging Het
Pax3 T C 1: 78,132,347 T225A probably damaging Het
Pbx1 C A 1: 168,183,565 A298S probably benign Het
Pcdhac2 A T 18: 37,146,282 K772* probably null Het
Pcsk4 A T 10: 80,325,817 Y163* probably null Het
Plcd3 A G 11: 103,080,644 V58A probably damaging Het
Plek2 T A 12: 78,900,093 T57S possibly damaging Het
Plscr2 C T 9: 92,287,668 T57I probably benign Het
Ppp2r5b A G 19: 6,234,738 S32P probably benign Het
Ppp3r2 C T 4: 49,682,022 probably benign Het
Psme4 T A 11: 30,865,567 L1693H probably damaging Het
Rrbp1 T A 2: 143,988,393 Q618L probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Serpina3b A T 12: 104,134,169 T337S probably benign Het
Slc18a2 T C 19: 59,293,878 Y506H probably benign Het
Slc9a9 A G 9: 94,936,429 Y292C probably benign Het
Spta1 T C 1: 174,224,520 V1840A probably benign Het
Ssb T C 2: 69,871,208 *416Q probably null Het
Strada A G 11: 106,168,436 V209A probably benign Het
Tbc1d31 A T 15: 57,936,093 D225V probably damaging Het
Tgm4 T C 9: 123,056,535 F381L probably benign Het
Tmem120b T A 5: 123,115,144 Y203N probably damaging Het
Tmem176b A G 6: 48,835,934 V109A probably benign Het
Tnfrsf11a C A 1: 105,819,946 L201M possibly damaging Het
Ttn C A 2: 76,974,350 probably null Het
Tubb2a T C 13: 34,075,343 I155V probably benign Het
Vmn1r5 A G 6: 56,986,114 D258G probably damaging Het
Vmn2r121 T C X: 124,133,575 T120A probably benign Het
Vmn2r19 A T 6: 123,329,948 I472F probably damaging Het
Vwa3a A G 7: 120,776,138 probably null Het
Zfp273 A G 13: 67,822,347 Y5C probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp825 A G 13: 74,480,653 L248P probably damaging Het
Other mutations in Mmp13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01976:Mmp13 APN 9 7278974 splice site probably benign
IGL02027:Mmp13 APN 9 7272955 missense probably damaging 1.00
IGL02320:Mmp13 APN 9 7278941 missense probably benign 0.00
R0143:Mmp13 UTSW 9 7276558 missense probably damaging 1.00
R0417:Mmp13 UTSW 9 7276602 missense probably benign
R0505:Mmp13 UTSW 9 7272929 missense probably damaging 1.00
R0624:Mmp13 UTSW 9 7280221 missense possibly damaging 0.69
R0632:Mmp13 UTSW 9 7274032 missense probably damaging 1.00
R0632:Mmp13 UTSW 9 7282077 missense possibly damaging 0.74
R1102:Mmp13 UTSW 9 7272952 missense possibly damaging 0.55
R1387:Mmp13 UTSW 9 7282033 missense possibly damaging 0.60
R1478:Mmp13 UTSW 9 7272892 missense probably damaging 1.00
R1669:Mmp13 UTSW 9 7277926 missense probably benign 0.01
R4647:Mmp13 UTSW 9 7274233 missense probably damaging 1.00
R4648:Mmp13 UTSW 9 7274233 missense probably damaging 1.00
R4668:Mmp13 UTSW 9 7272580 missense possibly damaging 0.54
R4827:Mmp13 UTSW 9 7278880 missense possibly damaging 0.68
R4898:Mmp13 UTSW 9 7272953 missense probably benign 0.10
R5780:Mmp13 UTSW 9 7278952 missense possibly damaging 0.76
R5946:Mmp13 UTSW 9 7276580 missense probably damaging 1.00
R5996:Mmp13 UTSW 9 7274269 missense probably damaging 1.00
R6693:Mmp13 UTSW 9 7280245 missense probably benign 0.00
R6789:Mmp13 UTSW 9 7272781 missense probably benign 0.00
R7310:Mmp13 UTSW 9 7280880 missense possibly damaging 0.60
T0722:Mmp13 UTSW 9 7280857 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- AAAGGGTCTTGCTTTCTCATTG -3'
(R):5'- TCAACAGAGGTCAGAAGCTTC -3'

Sequencing Primer
(F):5'- GTTTCTTGTTTTTCTTACAGGCTAC -3'
(R):5'- GGTCAGAAGCTTCATAATTTAAATGG -3'
Posted On2017-08-16