Incidental Mutation 'R6104:Pogz'
ID485416
Institutional Source Beutler Lab
Gene Symbol Pogz
Ensembl Gene ENSMUSG00000038902
Gene Namepogo transposable element with ZNF domain
Synonyms9530006B08Rik
MMRRC Submission 044254-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.760) question?
Stock #R6104 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location94837567-94882326 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94880031 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1310 (D1310G)
Ref Sequence ENSEMBL: ENSMUSP00000102891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005923] [ENSMUST00000042402] [ENSMUST00000107266] [ENSMUST00000107269] [ENSMUST00000107270]
Predicted Effect probably benign
Transcript: ENSMUST00000005923
SMART Domains Protein: ENSMUSP00000005923
Gene: ENSMUSG00000005779

DomainStartEndE-ValueType
Pfam:Proteasome 50 237 3.1e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042402
AA Change: D1301G

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000037523
Gene: ENSMUSG00000038902
AA Change: D1301G

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 239 266 N/A INTRINSIC
low complexity region 328 335 N/A INTRINSIC
PDB:2E72|A 362 393 5e-16 PDB
low complexity region 401 436 N/A INTRINSIC
ZnF_C2H2 482 504 1.64e-1 SMART
ZnF_C2H2 518 541 5.34e0 SMART
ZnF_C2H2 548 571 4.79e-3 SMART
ZnF_C2H2 578 601 9.3e-1 SMART
ZnF_C2H2 607 629 3.34e-2 SMART
ZnF_C2H2 635 657 1.13e1 SMART
ZnF_C2H2 758 781 9.46e0 SMART
ZnF_C2H2 802 827 5.26e1 SMART
low complexity region 896 915 N/A INTRINSIC
low complexity region 946 955 N/A INTRINSIC
low complexity region 984 996 N/A INTRINSIC
CENPB 1008 1072 3.84e-15 SMART
Pfam:DDE_1 1104 1289 3.3e-22 PFAM
low complexity region 1355 1365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107266
AA Change: D1257G

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000102887
Gene: ENSMUSG00000038902
AA Change: D1257G

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
low complexity region 186 213 N/A INTRINSIC
low complexity region 284 291 N/A INTRINSIC
PDB:2E72|A 318 349 6e-16 PDB
low complexity region 357 392 N/A INTRINSIC
ZnF_C2H2 438 460 1.64e-1 SMART
ZnF_C2H2 474 497 5.34e0 SMART
ZnF_C2H2 504 527 4.79e-3 SMART
ZnF_C2H2 534 557 9.3e-1 SMART
ZnF_C2H2 563 585 3.34e-2 SMART
ZnF_C2H2 591 613 1.13e1 SMART
ZnF_C2H2 714 737 9.46e0 SMART
ZnF_C2H2 758 783 5.26e1 SMART
low complexity region 852 871 N/A INTRINSIC
low complexity region 902 911 N/A INTRINSIC
low complexity region 940 952 N/A INTRINSIC
CENPB 964 1028 3.84e-15 SMART
Pfam:DDE_1 1060 1245 1.1e-22 PFAM
low complexity region 1311 1321 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107269
AA Change: D1215G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102890
Gene: ENSMUSG00000038902
AA Change: D1215G

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 144 171 N/A INTRINSIC
low complexity region 242 249 N/A INTRINSIC
PDB:2E72|A 276 307 5e-16 PDB
low complexity region 315 350 N/A INTRINSIC
ZnF_C2H2 396 418 1.64e-1 SMART
ZnF_C2H2 432 455 5.34e0 SMART
ZnF_C2H2 462 485 4.79e-3 SMART
ZnF_C2H2 492 515 9.3e-1 SMART
ZnF_C2H2 521 543 3.34e-2 SMART
ZnF_C2H2 549 571 1.13e1 SMART
ZnF_C2H2 672 695 9.46e0 SMART
ZnF_C2H2 716 741 5.26e1 SMART
low complexity region 810 829 N/A INTRINSIC
low complexity region 860 869 N/A INTRINSIC
low complexity region 898 910 N/A INTRINSIC
CENPB 922 986 3.84e-15 SMART
Pfam:DDE_1 1018 1203 1.1e-22 PFAM
low complexity region 1269 1279 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107270
AA Change: D1310G

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000102891
Gene: ENSMUSG00000038902
AA Change: D1310G

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 239 266 N/A INTRINSIC
low complexity region 337 344 N/A INTRINSIC
PDB:2E72|A 371 402 5e-16 PDB
low complexity region 410 445 N/A INTRINSIC
ZnF_C2H2 491 513 1.64e-1 SMART
ZnF_C2H2 527 550 5.34e0 SMART
ZnF_C2H2 557 580 4.79e-3 SMART
ZnF_C2H2 587 610 9.3e-1 SMART
ZnF_C2H2 616 638 3.34e-2 SMART
ZnF_C2H2 644 666 1.13e1 SMART
ZnF_C2H2 767 790 9.46e0 SMART
ZnF_C2H2 811 836 5.26e1 SMART
low complexity region 905 924 N/A INTRINSIC
low complexity region 955 964 N/A INTRINSIC
low complexity region 993 1005 N/A INTRINSIC
CENPB 1017 1081 3.84e-15 SMART
Pfam:DDE_1 1150 1298 1.5e-18 PFAM
low complexity region 1364 1374 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142253
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene appears to be a zinc finger protein containing a transposase domain at the C-terminus. This protein was found to interact with the transcription factor SP1 in a yeast two-hybrid system. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T A 2: 85,508,349 K149* probably null Het
Acot11 A T 4: 106,755,897 L327Q probably damaging Het
Atrip C T 9: 109,065,564 A432T possibly damaging Het
BC005561 T A 5: 104,518,218 I202K probably damaging Het
Chd6 T C 2: 161,014,132 T736A probably damaging Het
Cyp1b1 T A 17: 79,710,205 Y507F probably damaging Het
Desi2 G A 1: 178,249,452 R174H probably benign Het
Dopey1 A T 9: 86,520,807 K1351N possibly damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Fzd2 T C 11: 102,606,335 I535T probably damaging Het
Gpr15 A G 16: 58,717,976 F250S probably damaging Het
Grm6 T A 11: 50,859,317 I466N possibly damaging Het
Il17a A G 1: 20,732,274 Y69C probably damaging Het
Itgam A G 7: 128,116,302 D938G possibly damaging Het
Kmt2c T C 5: 25,299,129 D316G probably benign Het
Lrba C A 3: 86,353,792 A1485E probably damaging Het
Marf1 G A 16: 14,117,455 T1483I probably damaging Het
Myo18b T C 5: 112,874,291 probably benign Het
Myo5b T A 18: 74,700,679 I842N probably benign Het
Nckap5l C T 15: 99,423,988 S1092N probably benign Het
Nelfcd T C 2: 174,423,457 S273P probably damaging Het
Nt5c1b A G 12: 10,372,955 N83D probably damaging Het
Oas3 T A 5: 120,761,693 I709F unknown Het
Olfr1104 T C 2: 87,021,713 Y277C probably damaging Het
Olfr59 C A 11: 74,289,366 T240N probably damaging Het
Ppfia1 A G 7: 144,491,574 S949P possibly damaging Het
Pxylp1 A C 9: 96,824,747 F461V possibly damaging Het
Rcn3 A G 7: 45,091,523 Y54H probably damaging Het
Rnpepl1 A G 1: 92,915,884 H242R probably benign Het
Rps6ka5 A T 12: 100,553,148 D735E possibly damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr2 G A 13: 11,799,825 T687M probably damaging Het
Scn11a A G 9: 119,795,678 I526T probably damaging Het
Slc29a3 A G 10: 60,721,002 V211A possibly damaging Het
Syt10 A T 15: 89,826,864 H155Q probably benign Het
Taar8b A T 10: 24,092,237 S20T probably damaging Het
Tenm4 A T 7: 96,837,289 I988F probably damaging Het
Tlr3 A G 8: 45,403,093 S17P probably benign Het
Tmem87a A G 2: 120,394,424 S119P probably benign Het
Topaz1 A G 9: 122,749,866 T614A probably benign Het
Vmn2r80 A C 10: 79,149,020 N69H probably benign Het
Xylb T A 9: 119,364,507 *66R probably null Het
Ylpm1 G A 12: 85,029,630 R1043H probably benign Het
Ythdf3 G A 3: 16,205,161 V491I possibly damaging Het
Other mutations in Pogz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Pogz APN 3 94874703 unclassified probably benign
IGL02225:Pogz APN 3 94879016 missense probably damaging 0.99
IGL02377:Pogz APN 3 94879010 missense probably damaging 1.00
IGL02468:Pogz APN 3 94879083 missense probably damaging 0.97
IGL02672:Pogz APN 3 94856099 missense probably benign 0.08
IGL03290:Pogz APN 3 94875091 unclassified probably benign
FR4976:Pogz UTSW 3 94874695 unclassified probably benign
PIT4382001:Pogz UTSW 3 94879796 missense probably damaging 1.00
PIT4434001:Pogz UTSW 3 94872370 missense probably damaging 1.00
R0326:Pogz UTSW 3 94870113 missense probably damaging 1.00
R0401:Pogz UTSW 3 94877025 missense possibly damaging 0.81
R0479:Pogz UTSW 3 94876636 missense possibly damaging 0.92
R0586:Pogz UTSW 3 94879353 missense probably damaging 1.00
R1349:Pogz UTSW 3 94860888 missense probably damaging 1.00
R1372:Pogz UTSW 3 94860888 missense probably damaging 1.00
R1670:Pogz UTSW 3 94878849 missense probably benign 0.21
R1780:Pogz UTSW 3 94870126 missense possibly damaging 0.54
R1854:Pogz UTSW 3 94878849 missense probably benign 0.21
R1855:Pogz UTSW 3 94878849 missense probably benign 0.21
R1964:Pogz UTSW 3 94878193 missense probably benign 0.36
R1995:Pogz UTSW 3 94877944 missense probably damaging 1.00
R2109:Pogz UTSW 3 94878965 missense probably benign
R2139:Pogz UTSW 3 94871007 missense possibly damaging 0.95
R4457:Pogz UTSW 3 94856063 missense probably benign 0.14
R4598:Pogz UTSW 3 94880180 missense possibly damaging 0.52
R5598:Pogz UTSW 3 94864509 missense probably damaging 1.00
R5999:Pogz UTSW 3 94856117 missense possibly damaging 0.77
R7017:Pogz UTSW 3 94854024 missense probably damaging 0.99
Z1088:Pogz UTSW 3 94879076 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGCTCCAAAATCCAGCC -3'
(R):5'- AAGCTGGTGAAGGCTTTCAGG -3'

Sequencing Primer
(F):5'- ATCCAGCCACTAGATGTATGC -3'
(R):5'- GCTCGACTGTCTCTTCAGGAG -3'
Posted On2017-08-16