Incidental Mutation 'R6104:Olfr59'
ID485438
Institutional Source Beutler Lab
Gene Symbol Olfr59
Ensembl Gene ENSMUSG00000070374
Gene Nameolfactory receptor 59
SynonymsMOR133-3P, IH3, GA_x6K02T2P1NL-4434429-4435400
MMRRC Submission 044254-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R6104 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location74283736-74291608 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 74289366 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 240 (T240N)
Ref Sequence ENSEMBL: ENSMUSP00000148959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143976] [ENSMUST00000205790] [ENSMUST00000206659] [ENSMUST00000214048]
Predicted Effect probably damaging
Transcript: ENSMUST00000119717
AA Change: T240N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112522
Gene: ENSMUSG00000070374
AA Change: T240N

DomainStartEndE-ValueType
Pfam:7tm_4 31 310 2.2e-59 PFAM
Pfam:7tm_1 41 292 3.2e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143976
AA Change: T240N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119877
Gene: ENSMUSG00000070374
AA Change: T240N

DomainStartEndE-ValueType
Pfam:7tm_1 41 237 7.5e-34 PFAM
Pfam:7tm_4 139 237 1.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205790
Predicted Effect probably benign
Transcript: ENSMUST00000206659
Predicted Effect probably damaging
Transcript: ENSMUST00000214048
AA Change: T240N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T A 2: 85,508,349 K149* probably null Het
Acot11 A T 4: 106,755,897 L327Q probably damaging Het
Atrip C T 9: 109,065,564 A432T possibly damaging Het
BC005561 T A 5: 104,518,218 I202K probably damaging Het
Chd6 T C 2: 161,014,132 T736A probably damaging Het
Cyp1b1 T A 17: 79,710,205 Y507F probably damaging Het
Desi2 G A 1: 178,249,452 R174H probably benign Het
Dopey1 A T 9: 86,520,807 K1351N possibly damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Fzd2 T C 11: 102,606,335 I535T probably damaging Het
Gpr15 A G 16: 58,717,976 F250S probably damaging Het
Grm6 T A 11: 50,859,317 I466N possibly damaging Het
Il17a A G 1: 20,732,274 Y69C probably damaging Het
Itgam A G 7: 128,116,302 D938G possibly damaging Het
Kmt2c T C 5: 25,299,129 D316G probably benign Het
Lrba C A 3: 86,353,792 A1485E probably damaging Het
Marf1 G A 16: 14,117,455 T1483I probably damaging Het
Myo18b T C 5: 112,874,291 probably benign Het
Myo5b T A 18: 74,700,679 I842N probably benign Het
Nckap5l C T 15: 99,423,988 S1092N probably benign Het
Nelfcd T C 2: 174,423,457 S273P probably damaging Het
Nt5c1b A G 12: 10,372,955 N83D probably damaging Het
Oas3 T A 5: 120,761,693 I709F unknown Het
Olfr1104 T C 2: 87,021,713 Y277C probably damaging Het
Pogz A G 3: 94,880,031 D1310G probably benign Het
Ppfia1 A G 7: 144,491,574 S949P possibly damaging Het
Pxylp1 A C 9: 96,824,747 F461V possibly damaging Het
Rcn3 A G 7: 45,091,523 Y54H probably damaging Het
Rnpepl1 A G 1: 92,915,884 H242R probably benign Het
Rps6ka5 A T 12: 100,553,148 D735E possibly damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr2 G A 13: 11,799,825 T687M probably damaging Het
Scn11a A G 9: 119,795,678 I526T probably damaging Het
Slc29a3 A G 10: 60,721,002 V211A possibly damaging Het
Syt10 A T 15: 89,826,864 H155Q probably benign Het
Taar8b A T 10: 24,092,237 S20T probably damaging Het
Tenm4 A T 7: 96,837,289 I988F probably damaging Het
Tlr3 A G 8: 45,403,093 S17P probably benign Het
Tmem87a A G 2: 120,394,424 S119P probably benign Het
Topaz1 A G 9: 122,749,866 T614A probably benign Het
Vmn2r80 A C 10: 79,149,020 N69H probably benign Het
Xylb T A 9: 119,364,507 *66R probably null Het
Ylpm1 G A 12: 85,029,630 R1043H probably benign Het
Ythdf3 G A 3: 16,205,161 V491I possibly damaging Het
Other mutations in Olfr59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Olfr59 APN 11 74289126 missense probably damaging 1.00
IGL00337:Olfr59 APN 11 74289387 missense probably damaging 0.97
IGL01307:Olfr59 APN 11 74289428 missense possibly damaging 0.88
IGL01488:Olfr59 APN 11 74288688 missense probably damaging 1.00
IGL02583:Olfr59 APN 11 74289504 missense probably damaging 1.00
IGL02839:Olfr59 APN 11 74289370 nonsense probably null
IGL02996:Olfr59 APN 11 74289165 missense probably benign 0.08
R0013:Olfr59 UTSW 11 74289051 missense possibly damaging 0.88
R0077:Olfr59 UTSW 11 74288675 missense probably benign 0.00
R0078:Olfr59 UTSW 11 74289266 missense probably damaging 1.00
R0734:Olfr59 UTSW 11 74288946 missense probably damaging 1.00
R1033:Olfr59 UTSW 11 74288666 missense probably damaging 0.99
R1556:Olfr59 UTSW 11 74288936 missense probably damaging 1.00
R1721:Olfr59 UTSW 11 74289300 missense probably damaging 1.00
R1737:Olfr59 UTSW 11 74288811 missense probably damaging 1.00
R1848:Olfr59 UTSW 11 74289213 missense probably damaging 0.99
R1881:Olfr59 UTSW 11 74288666 missense probably benign 0.08
R2057:Olfr59 UTSW 11 74288826 missense probably damaging 1.00
R2107:Olfr59 UTSW 11 74289390 missense probably damaging 1.00
R4399:Olfr59 UTSW 11 74288856 missense probably damaging 1.00
R4633:Olfr59 UTSW 11 74289294 missense probably benign 0.00
R5593:Olfr59 UTSW 11 74288792 missense possibly damaging 0.65
R5988:Olfr59 UTSW 11 74288853 missense probably benign
R7436:Olfr59 UTSW 11 74288685 missense possibly damaging 0.84
R7506:Olfr59 UTSW 11 74289123 missense possibly damaging 0.96
Z1088:Olfr59 UTSW 11 74288835 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCTGTGATCTGGGACCC -3'
(R):5'- TTGCCCTTGAGAATTCTGACCAG -3'

Sequencing Primer
(F):5'- TGATCTGGGACCCCTAATGAAGATC -3'
(R):5'- GAGAATTCTGACCAGTGCTCC -3'
Posted On2017-08-16