Incidental Mutation 'R6104:Cyp1b1'
ID485449
Institutional Source Beutler Lab
Gene Symbol Cyp1b1
Ensembl Gene ENSMUSG00000024087
Gene Namecytochrome P450, family 1, subfamily b, polypeptide 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.373) question?
Stock #R6104 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location79706953-79715041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79710205 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 507 (Y507F)
Ref Sequence ENSEMBL: ENSMUSP00000024894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024894]
Predicted Effect probably damaging
Transcript: ENSMUST00000024894
AA Change: Y507F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024894
Gene: ENSMUSG00000024087
AA Change: Y507F

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Pfam:p450 51 520 1.3e-100 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The enzyme encoded by this gene localizes to the endoplasmic reticulum and metabolizes procarcinogens such as polycyclic aromatic hydrocarbons and 17beta-estradiol. Mutations in this gene have been associated with primary congenital glaucoma; therefore it is thought that the enzyme also metabolizes a signaling molecule involved in eye development, possibly a steroid. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are protected from the acute bone marrow cytotoxic and preleukemic effects of DMBA, show a decreased incidence of DMBA-induced lymphomas, and display background-sensitive ocular abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T A 2: 85,508,349 K149* probably null Het
Acot11 A T 4: 106,755,897 L327Q probably damaging Het
Atrip C T 9: 109,065,564 A432T possibly damaging Het
BC005561 T A 5: 104,518,218 I202K probably damaging Het
Chd6 T C 2: 161,014,132 T736A probably damaging Het
Desi2 G A 1: 178,249,452 R174H probably benign Het
Dopey1 A T 9: 86,520,807 K1351N possibly damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Fzd2 T C 11: 102,606,335 I535T probably damaging Het
Gpr15 A G 16: 58,717,976 F250S probably damaging Het
Grm6 T A 11: 50,859,317 I466N possibly damaging Het
Il17a A G 1: 20,732,274 Y69C probably damaging Het
Itgam A G 7: 128,116,302 D938G possibly damaging Het
Kmt2c T C 5: 25,299,129 D316G probably benign Het
Lrba C A 3: 86,353,792 A1485E probably damaging Het
Marf1 G A 16: 14,117,455 T1483I probably damaging Het
Myo18b T C 5: 112,874,291 probably benign Het
Myo5b T A 18: 74,700,679 I842N probably benign Het
Nckap5l C T 15: 99,423,988 S1092N probably benign Het
Nelfcd T C 2: 174,423,457 S273P probably damaging Het
Nt5c1b A G 12: 10,372,955 N83D probably damaging Het
Oas3 T A 5: 120,761,693 I709F unknown Het
Olfr1104 T C 2: 87,021,713 Y277C probably damaging Het
Olfr59 C A 11: 74,289,366 T240N probably damaging Het
Pogz A G 3: 94,880,031 D1310G probably benign Het
Ppfia1 A G 7: 144,491,574 S949P possibly damaging Het
Pxylp1 A C 9: 96,824,747 F461V possibly damaging Het
Rcn3 A G 7: 45,091,523 Y54H probably damaging Het
Rnpepl1 A G 1: 92,915,884 H242R probably benign Het
Rps6ka5 A T 12: 100,553,148 D735E possibly damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr2 G A 13: 11,799,825 T687M probably damaging Het
Scn11a A G 9: 119,795,678 I526T probably damaging Het
Slc29a3 A G 10: 60,721,002 V211A possibly damaging Het
Syt10 A T 15: 89,826,864 H155Q probably benign Het
Taar8b A T 10: 24,092,237 S20T probably damaging Het
Tenm4 A T 7: 96,837,289 I988F probably damaging Het
Tlr3 A G 8: 45,403,093 S17P probably benign Het
Tmem87a A G 2: 120,394,424 S119P probably benign Het
Topaz1 A G 9: 122,749,866 T614A probably benign Het
Vmn2r80 A C 10: 79,149,020 N69H probably benign Het
Xylb T A 9: 119,364,507 *66R probably null Het
Ylpm1 G A 12: 85,029,630 R1043H probably benign Het
Ythdf3 G A 3: 16,205,161 V491I possibly damaging Het
Other mutations in Cyp1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0387:Cyp1b1 UTSW 17 79713774 missense probably benign
R0400:Cyp1b1 UTSW 17 79713587 missense probably damaging 1.00
R0456:Cyp1b1 UTSW 17 79710275 missense probably benign 0.02
R0681:Cyp1b1 UTSW 17 79713846 missense probably damaging 0.97
R2851:Cyp1b1 UTSW 17 79710220 missense probably benign 0.00
R2897:Cyp1b1 UTSW 17 79713731 missense probably benign 0.00
R4706:Cyp1b1 UTSW 17 79713342 missense possibly damaging 0.86
R5070:Cyp1b1 UTSW 17 79710611 missense probably benign
R6195:Cyp1b1 UTSW 17 79714266 missense probably damaging 1.00
R6233:Cyp1b1 UTSW 17 79714266 missense probably damaging 1.00
X0067:Cyp1b1 UTSW 17 79710691 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATTCACTGCTGAGAGCTGAG -3'
(R):5'- CAAGGACGGCTTCATTAACAAGG -3'

Sequencing Primer
(F):5'- CTGAGGCCAAAAATGAAGCTG -3'
(R):5'- GGCTTCATTAACAAGGCGCTAGC -3'
Posted On2017-08-16