Incidental Mutation 'R6105:Aldh4a1'
ID485460
Institutional Source Beutler Lab
Gene Symbol Aldh4a1
Ensembl Gene ENSMUSG00000028737
Gene Namealdehyde dehydrogenase 4 family, member A1
SynonymsP5CDH, Ssdh1, A930035F14Rik, ALDH4, Ahd1, Ahd-1
MMRRC Submission 044255-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.227) question?
Stock #R6105 (G1)
Quality Score216.009
Status Not validated
Chromosome4
Chromosomal Location139622866-139649690 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 139638495 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 266 (P266S)
Ref Sequence ENSEMBL: ENSMUSP00000043821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039818] [ENSMUST00000178644]
PDB Structure
Crystal structure of mouse 1-pyrroline-5-carboxylate dehydrogenase complexed with sulfate ion [X-RAY DIFFRACTION]
Crystal structure of mouse 1-pyrroline-5-carboxylate dehydrogenase complexed with the product glutamate [X-RAY DIFFRACTION]
Crystal structure of mouse 1-pyrroline-5-carboxylate dehydrogenase complexed with NAD+ [X-RAY DIFFRACTION]
Crystal Structure of Mus musculus 1-pyrroline-5-carboxylate dehydrogenase cryoprotected in proline [X-RAY DIFFRACTION]
Structure of mouse 1-Pyrroline-5-Carboxylate Dehydrogenase (ALDH4A1) complexed with acetate [X-RAY DIFFRACTION]
Structure of mouse 1-Pyrroline-5-Carboxylate Dehydrogenase (ALDH4A1) complexed with glyoxylate [X-RAY DIFFRACTION]
Structure of mouse 1-Pyrroline-5-Carboxylate Dehydrogenase (ALDH4A1) complexed with malonate [X-RAY DIFFRACTION]
Structure of mouse 1-Pyrroline-5-Carboxylate Dehydrogenase (ALDH4A1) complexed with succinate [X-RAY DIFFRACTION]
Structure of mouse 1-Pyrroline-5-Carboxylate Dehydrogenase (ALDH4A1) complexed with glutarate [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039818
AA Change: P266S

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043821
Gene: ENSMUSG00000028737
AA Change: P266S

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Aldedh 73 546 7.6e-104 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146309
Predicted Effect probably benign
Transcript: ENSMUST00000178644
SMART Domains Protein: ENSMUSP00000136776
Gene: ENSMUSG00000094439

DomainStartEndE-ValueType
SCOP:d1lbva_ 1 60 5e-3 SMART
Pfam:Filament 165 253 7.3e-13 PFAM
low complexity region 255 268 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenase family of proteins. This enzyme is a mitochondrial matrix NAD-dependent dehydrogenase which catalyzes the second step of the proline degradation pathway, converting pyrroline-5-carboxylate to glutamate. Deficiency of this enzyme is associated with type II hyperprolinemia, an autosomal recessive disorder characterized by accumulation of delta-1-pyrroline-5-carboxylate (P5C) and proline. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,397,812 M3555T probably damaging Het
Adam9 A T 8: 24,970,759 C570S probably damaging Het
Adh6b T A 3: 138,357,710 I350K possibly damaging Het
Ahnak G A 19: 9,004,099 V916I probably benign Het
Cnot7 C T 8: 40,510,037 R32Q probably benign Het
Cyb5a G A 18: 84,871,593 R49Q possibly damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Glul T A 1: 153,906,431 Y137* probably null Het
Ipo8 A G 6: 148,798,670 Y570H probably damaging Het
Kif2b A G 11: 91,575,988 S490P probably benign Het
Kxd1 A T 8: 70,519,939 N33K probably benign Het
Man2a2 T C 7: 80,367,001 D355G probably damaging Het
Map6 T C 7: 99,268,107 V29A probably damaging Het
Mtmr3 T C 11: 4,485,432 D1116G probably damaging Het
Olfr1198 T A 2: 88,746,840 H16L probably benign Het
Olfr917 A G 9: 38,665,620 S75P probably damaging Het
Olfr926 T C 9: 38,877,308 L44P possibly damaging Het
Pak1ip1 T A 13: 41,004,885 L78Q probably damaging Het
Phf10 C T 17: 14,954,125 probably null Het
Pikfyve A G 1: 65,264,345 probably null Het
Pkd1l3 A G 8: 109,640,846 D1225G probably damaging Het
Postn A G 3: 54,372,220 probably null Het
Slc22a30 T C 19: 8,337,868 probably null Het
Specc1l T C 10: 75,248,632 S730P probably damaging Het
Steap2 T A 5: 5,675,891 I378F possibly damaging Het
Sult4a1 T A 15: 84,086,620 K195* probably null Het
Tgfb1i1 T A 7: 128,248,417 probably null Het
Thbs4 G T 13: 92,775,485 Q246K possibly damaging Het
Tnfsf10 A G 3: 27,335,549 Y253C probably damaging Het
Tnpo3 G T 6: 29,588,043 C125* probably null Het
Trappc8 A G 18: 20,846,447 probably null Het
Trpm6 C T 19: 18,853,748 R1326* probably null Het
Vmn2r19 A C 6: 123,316,095 E365D possibly damaging Het
Vps18 A G 2: 119,289,062 Y8C probably damaging Het
Zc3hav1l A G 6: 38,293,077 V279A probably benign Het
Zfp111 T C 7: 24,203,366 probably null Het
Zfp618 A T 4: 63,133,241 Q753L probably benign Het
Zkscan17 A T 11: 59,503,575 C67S probably damaging Het
Other mutations in Aldh4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Aldh4a1 APN 4 139642160 nonsense probably null
IGL01916:Aldh4a1 APN 4 139644146 missense probably damaging 1.00
IGL02368:Aldh4a1 APN 4 139648200 nonsense probably null
IGL02469:Aldh4a1 APN 4 139648161 missense probably damaging 0.98
PIT4402001:Aldh4a1 UTSW 4 139642191 nonsense probably null
R0511:Aldh4a1 UTSW 4 139642571 splice site probably benign
R1352:Aldh4a1 UTSW 4 139635519 missense probably benign 0.18
R1484:Aldh4a1 UTSW 4 139643447 missense probably benign 0.00
R1717:Aldh4a1 UTSW 4 139638529 missense possibly damaging 0.93
R1717:Aldh4a1 UTSW 4 139633994 splice site probably null
R1729:Aldh4a1 UTSW 4 139644161 missense probably damaging 1.00
R1784:Aldh4a1 UTSW 4 139644161 missense probably damaging 1.00
R1785:Aldh4a1 UTSW 4 139644128 missense probably benign 0.01
R1786:Aldh4a1 UTSW 4 139644128 missense probably benign 0.01
R3696:Aldh4a1 UTSW 4 139642251 missense possibly damaging 0.68
R3697:Aldh4a1 UTSW 4 139642251 missense possibly damaging 0.68
R3698:Aldh4a1 UTSW 4 139642251 missense possibly damaging 0.68
R4603:Aldh4a1 UTSW 4 139643429 missense probably damaging 0.97
R5197:Aldh4a1 UTSW 4 139648301 intron probably benign
R5375:Aldh4a1 UTSW 4 139633922 missense probably benign
R5539:Aldh4a1 UTSW 4 139638522 missense probably benign 0.05
R5590:Aldh4a1 UTSW 4 139642104 missense probably damaging 1.00
R6101:Aldh4a1 UTSW 4 139638495 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ATGGTTGGTCTTTCGCCACC -3'
(R):5'- TTCACCAAGATAGGGACCCCTC -3'

Sequencing Primer
(F):5'- ACCTTGTGAATCATGTTTGACACC -3'
(R):5'- ACTCTCATTCGGCACAGTGG -3'
Posted On2017-08-16