Mutagenetix > Incidental Mutation

Incidental Mutation 'R6105:Cnot7'

485472

Institutional Source

Beutler Lab

Gene Symbol

Cnot7

Ensembl Gene

ENSMUSG00000031601

Gene Name

CCR4-NOT transcription complex, subunit 7

Synonyms

Caf1

MMRRC Submission

044255-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.509) question?

Stock #

R6105 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

40945581-40968888 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 40963078 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 32 (R32Q)

Ref Sequence

ENSEMBL: ENSMUSP00000117304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034012] [ENSMUST00000098817] [ENSMUST00000128166] [ENSMUST00000132032] [ENSMUST00000149992] [ENSMUST00000135269]

AlphaFold

Q60809

Predicted Effect

probably benign
Transcript: ENSMUST00000034012
AA Change: R32Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000034012
Gene: ENSMUSG00000031601
AA Change: R32Q

Domain	Start	End	E-Value	Type
Pfam:CAF1	15	139	9.1e-15	PFAM
Pfam:CAF1	132	238	1.2e-14	PFAM
low complexity region	259	268	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000098817

SMART Domains

Protein: ENSMUSP00000096415
Gene: ENSMUSG00000031600

Domain	Start	End	E-Value	Type
low complexity region	6	22	N/A	INTRINSIC
Blast:UBCc	29	128	6e-6	BLAST
low complexity region	155	164	N/A	INTRINSIC
low complexity region	171	189	N/A	INTRINSIC
Pfam:Mod_r	235	380	2.7e-39	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128166

SMART Domains

Protein: ENSMUSP00000123070
Gene: ENSMUSG00000039470

Domain	Start	End	E-Value	Type
transmembrane domain	16	38	N/A	INTRINSIC
transmembrane domain	48	70	N/A	INTRINSIC
Pfam:zf-DHHC	122	248	1.8e-37	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128237

Predicted Effect

probably benign
Transcript: ENSMUST00000132032
AA Change: R32Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000122933
Gene: ENSMUSG00000031601
AA Change: R32Q

Domain	Start	End	E-Value	Type
Pfam:CAF1	13	240	3.4e-73	PFAM
low complexity region	259	268	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132200

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132740

Predicted Effect

probably benign
Transcript: ENSMUST00000149992
AA Change: R32Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000117304
Gene: ENSMUSG00000031601
AA Change: R32Q

Domain	Start	End	E-Value	Type
Pfam:CAF1	13	240	3.4e-73	PFAM
low complexity region	259	268	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135269
AA Change: R32Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000119319
Gene: ENSMUSG00000031601
AA Change: R32Q

Domain	Start	End	E-Value	Type
Pfam:CAF1	13	245	7e-66	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146280

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164934

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139558

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144970

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to an anti-proliferative protein, B-cell translocation protein 1, which negatively regulates cell proliferation. Binding of the two proteins, which is driven by phosphorylation of the anti-proliferative protein, causes signaling events in cell division that lead to changes in cell proliferation associated with cell-cell contact. The encoded protein downregulates the innate immune response and therefore provides a therapeutic target for enhancing its antimicrobial activity against foreign agents. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 1 and X. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous null mice display male sterility with oligo-teratozoospermia, impaired sperm motility, unsynchronized spermatid maturation, and Sertoli cell abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,347,812 (GRCm39)	M3555T	probably damaging	Het
Adam9	A	T	8: 25,460,775 (GRCm39)	C570S	probably damaging	Het
Adh6b	T	A	3: 138,063,471 (GRCm39)	I350K	possibly damaging	Het
Ahnak	G	A	19: 8,981,463 (GRCm39)	V916I	probably benign	Het
Aldh4a1	C	T	4: 139,365,806 (GRCm39)	P266S	possibly damaging	Het
Cyb5a	G	A	18: 84,889,718 (GRCm39)	R49Q	possibly damaging	Het
Fbxo6	A	T	4: 148,233,979 (GRCm39)	I39N	probably damaging	Het
Glul	T	A	1: 153,782,177 (GRCm39)	Y137*	probably null	Het
Ipo8	A	G	6: 148,700,168 (GRCm39)	Y570H	probably damaging	Het
Kif2b	A	G	11: 91,466,814 (GRCm39)	S490P	probably benign	Het
Kxd1	A	T	8: 70,972,589 (GRCm39)	N33K	probably benign	Het
Man2a2	T	C	7: 80,016,749 (GRCm39)	D355G	probably damaging	Het
Map6	T	C	7: 98,917,314 (GRCm39)	V29A	probably damaging	Het
Mtmr3	T	C	11: 4,435,432 (GRCm39)	D1116G	probably damaging	Het
Or4p23	T	A	2: 88,577,184 (GRCm39)	H16L	probably benign	Het
Or8b52	A	G	9: 38,576,916 (GRCm39)	S75P	probably damaging	Het
Or8d2b	T	C	9: 38,788,604 (GRCm39)	L44P	possibly damaging	Het
Pak1ip1	T	A	13: 41,158,361 (GRCm39)	L78Q	probably damaging	Het
Phf10	C	T	17: 15,174,387 (GRCm39)		probably null	Het
Pikfyve	A	G	1: 65,303,504 (GRCm39)		probably null	Het
Pkd1l3	A	G	8: 110,367,478 (GRCm39)	D1225G	probably damaging	Het
Postn	A	G	3: 54,279,641 (GRCm39)		probably null	Het
Slc22a30	T	C	19: 8,315,232 (GRCm39)		probably null	Het
Specc1l	T	C	10: 75,084,466 (GRCm39)	S730P	probably damaging	Het
Steap2	T	A	5: 5,725,891 (GRCm39)	I378F	possibly damaging	Het
Sult4a1	T	A	15: 83,970,821 (GRCm39)	K195*	probably null	Het
Tgfb1i1	T	A	7: 127,847,589 (GRCm39)		probably null	Het
Thbs4	G	T	13: 92,911,993 (GRCm39)	Q246K	possibly damaging	Het
Tnfsf10	A	G	3: 27,389,698 (GRCm39)	Y253C	probably damaging	Het
Tnpo3	G	T	6: 29,588,042 (GRCm39)	C125*	probably null	Het
Trappc8	A	G	18: 20,979,504 (GRCm39)		probably null	Het
Trpm6	C	T	19: 18,831,112 (GRCm39)	R1326*	probably null	Het
Vmn2r19	A	C	6: 123,293,054 (GRCm39)	E365D	possibly damaging	Het
Vps18	A	G	2: 119,119,543 (GRCm39)	Y8C	probably damaging	Het
Zc3hav1l	A	G	6: 38,270,012 (GRCm39)	V279A	probably benign	Het
Zfp111	T	C	7: 23,902,791 (GRCm39)		probably null	Het
Zfp618	A	T	4: 63,051,478 (GRCm39)	Q753L	probably benign	Het
Zkscan17	A	T	11: 59,394,401 (GRCm39)	C67S	probably damaging	Het

Other mutations in Cnot7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01474:Cnot7	APN	8	40,960,490 (GRCm39)	splice site	probably null
IGL02022:Cnot7	APN	8	40,952,386 (GRCm39)	missense	probably damaging	1.00
IGL02191:Cnot7	APN	8	40,963,068 (GRCm39)	missense	probably benign	0.33
R0047:Cnot7	UTSW	8	40,948,962 (GRCm39)	splice site	probably benign
R0047:Cnot7	UTSW	8	40,948,962 (GRCm39)	splice site	probably benign
R0166:Cnot7	UTSW	8	40,960,494 (GRCm39)	critical splice donor site	probably null
R3884:Cnot7	UTSW	8	40,963,171 (GRCm39)	start codon destroyed	probably null	0.01
R5369:Cnot7	UTSW	8	40,947,061 (GRCm39)	missense	probably benign	0.12
R5991:Cnot7	UTSW	8	40,948,696 (GRCm39)	splice site	probably null
R6101:Cnot7	UTSW	8	40,963,078 (GRCm39)	missense	probably benign
R7299:Cnot7	UTSW	8	40,960,586 (GRCm39)	missense	probably damaging	1.00
R7548:Cnot7	UTSW	8	40,953,874 (GRCm39)	missense	probably damaging	1.00
R7639:Cnot7	UTSW	8	40,960,494 (GRCm39)	critical splice donor site	probably null
R7712:Cnot7	UTSW	8	40,947,122 (GRCm39)	missense	probably damaging	1.00
R8069:Cnot7	UTSW	8	40,960,514 (GRCm39)	missense	possibly damaging	0.95
R8128:Cnot7	UTSW	8	40,963,129 (GRCm39)	missense	probably damaging	1.00
R8757:Cnot7	UTSW	8	40,947,080 (GRCm39)	missense	probably benign
R9251:Cnot7	UTSW	8	40,964,622 (GRCm39)	unclassified	probably benign
Z1088:Cnot7	UTSW	8	40,953,780 (GRCm39)	critical splice donor site	probably benign

Predicted Primers

PCR Primer
(F):5'- TGGTTTTAACAGCCCACTCC -3'
(R):5'- TTTCAACAGGTGCATAAGTAAAGGG -3'

Sequencing Primer
(F):5'- CTATGCTTAAAAGGTGCATGGCCC -3'
(R):5'- CAGGTGCATAAGTAAAGGGTAAAG -3'

Posted On

2017-08-16