Incidental Mutation 'R6106:Tomm34'
ID485494
Institutional Source Beutler Lab
Gene Symbol Tomm34
Ensembl Gene ENSMUSG00000018322
Gene Nametranslocase of outer mitochondrial membrane 34
Synonyms2610100K07Rik, TOM34
MMRRC Submission 044256-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R6106 (G1)
Quality Score215.009
Status Not validated
Chromosome2
Chromosomal Location164053540-164071169 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 164060991 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 133 (M133T)
Ref Sequence ENSEMBL: ENSMUSP00000105010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018466] [ENSMUST00000109384]
Predicted Effect probably benign
Transcript: ENSMUST00000018466
AA Change: M133T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000018466
Gene: ENSMUSG00000018322
AA Change: M133T

DomainStartEndE-ValueType
TPR 9 42 1.4e1 SMART
TPR 51 84 4.21e-3 SMART
TPR 85 118 2.55e-2 SMART
low complexity region 167 182 N/A INTRINSIC
TPR 193 226 1.56e1 SMART
TPR 227 260 5.51e-7 SMART
TPR 261 294 3.67e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109384
AA Change: M133T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105010
Gene: ENSMUSG00000018322
AA Change: M133T

DomainStartEndE-ValueType
TPR 9 42 1.73e1 SMART
TPR 51 84 4.21e-3 SMART
TPR 85 118 2.55e-2 SMART
low complexity region 167 182 N/A INTRINSIC
TPR 193 226 1.56e1 SMART
TPR 227 260 5.51e-7 SMART
TPR 261 294 3.67e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132602
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the import of precursor proteins into mitochondria. The encoded protein has a chaperone-like activity, binding the mature portion of unfolded proteins and aiding their import into mitochondria. This protein, which is found in the cytoplasm and sometimes associated with the outer mitochondrial membrane, has a weak ATPase activity and contains 6 TPR repeats. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are fertile and males do not display any defects in the testes or in spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,613,412 T1105A possibly damaging Het
Ace A G 11: 105,989,012 E726G probably damaging Het
Adgrl4 A G 3: 151,540,985 I641V possibly damaging Het
Apoa5 A T 9: 46,270,633 R336* probably null Het
Bfsp2 T A 9: 103,479,824 T135S probably benign Het
Calhm2 A T 19: 47,133,062 Y223N probably damaging Het
Ccdc158 T C 5: 92,627,466 E960G probably benign Het
Ccdc80 T C 16: 45,096,710 S610P probably benign Het
Cdon T A 9: 35,455,408 Y193* probably null Het
Cept1 A T 3: 106,503,676 H400Q probably benign Het
Clspn T A 4: 126,590,641 N1197K probably benign Het
Cnot8 T C 11: 58,113,990 S172P probably damaging Het
Col14a1 T C 15: 55,520,008 I1794T probably damaging Het
Fam183b T C 11: 58,796,601 E66G probably damaging Het
Fam193a A T 5: 34,459,030 T564S possibly damaging Het
Galnt1 G A 18: 24,254,663 V154I probably benign Het
Gm14139 A G 2: 150,192,805 K349E probably damaging Het
Gstcd C A 3: 132,998,914 E526D probably benign Het
Ighv1-42 A C 12: 114,937,287 S59R probably benign Het
Morn3 A G 5: 123,046,760 C6R possibly damaging Het
Nrd1 A T 4: 109,044,585 K617M probably damaging Het
Olfr169 A G 16: 19,566,259 L208P probably damaging Het
Olfr632 A G 7: 103,938,193 H271R probably benign Het
Olfr883 T A 9: 38,026,466 I220N probably damaging Het
Olfr913 T C 9: 38,594,956 M245T probably benign Het
Pcdhb11 A G 18: 37,423,003 N462S probably damaging Het
Pfpl G T 19: 12,429,461 D359Y probably damaging Het
Phyhip T C 14: 70,461,859 V34A probably benign Het
Pigu A T 2: 155,297,196 I313N possibly damaging Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Psg16 T A 7: 17,095,166 F225Y possibly damaging Het
Setdb2 T A 14: 59,423,449 K82* probably null Het
Sgms1 A G 19: 32,124,425 S394P possibly damaging Het
Slc16a1 T C 3: 104,652,994 L205P probably benign Het
Slc19a1 T A 10: 77,044,769 I380N probably damaging Het
Snx32 A G 19: 5,498,014 I131T probably benign Het
Sorbs3 T C 14: 70,192,604 probably null Het
Stc2 T A 11: 31,360,392 I215L probably benign Het
Tln2 C T 9: 67,323,020 A84T probably damaging Het
Usp43 A G 11: 67,879,907 S634P probably benign Het
Vmn2r59 T A 7: 42,012,325 R689* probably null Het
Vmn2r9 C T 5: 108,845,036 R536Q probably benign Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Zfhx2 T A 14: 55,068,310 probably null Het
Zfp608 G T 18: 54,987,872 H214Q possibly damaging Het
Zfp619 T C 7: 39,535,134 V196A probably benign Het
Other mutations in Tomm34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Tomm34 APN 2 164058662 splice site probably benign
IGL02426:Tomm34 APN 2 164064955 missense probably damaging 1.00
R0744:Tomm34 UTSW 2 164070976 missense probably benign 0.34
R1938:Tomm34 UTSW 2 164061006 missense probably benign 0.00
R4506:Tomm34 UTSW 2 164054372 unclassified probably null
R4541:Tomm34 UTSW 2 164054799 missense probably benign 0.03
R4869:Tomm34 UTSW 2 164054717 missense probably damaging 1.00
R5080:Tomm34 UTSW 2 164070896 intron probably benign
R7037:Tomm34 UTSW 2 164070478 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCTCTAAACTTAGCCCC -3'
(R):5'- CAACCATGCTAAGGGAAGTGCC -3'

Sequencing Primer
(F):5'- CAGCCCAGCTCACCTCTG -3'
(R):5'- CCCCGTGGTGTTGGATC -3'
Posted On2017-08-16