Incidental Mutation 'R6106:Adgrl4'
ID485500
Institutional Source Beutler Lab
Gene Symbol Adgrl4
Ensembl Gene ENSMUSG00000039167
Gene Nameadhesion G protein-coupled receptor L4
SynonymsEltd1, Etl, EGF-TM7 receptor, 1110033N21Rik
MMRRC Submission 044256-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6106 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location151437887-151545086 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 151540985 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 641 (I641V)
Ref Sequence ENSEMBL: ENSMUSP00000041939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046977]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046977
AA Change: I641V

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000041939
Gene: ENSMUSG00000039167
AA Change: I641V

DomainStartEndE-ValueType
EGF 21 57 9.13e0 SMART
EGF_CA 58 107 4.88e-9 SMART
EGF_CA 108 157 4.88e-9 SMART
Pfam:GAIN 182 390 6.8e-38 PFAM
GPS 414 467 1.25e-17 SMART
Pfam:7tm_2 473 709 2.5e-58 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: For a targeted mutation, no significant differences were detected between homozygous mice and controls in a high-throughput screen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,613,412 T1105A possibly damaging Het
Ace A G 11: 105,989,012 E726G probably damaging Het
Apoa5 A T 9: 46,270,633 R336* probably null Het
Bfsp2 T A 9: 103,479,824 T135S probably benign Het
Calhm2 A T 19: 47,133,062 Y223N probably damaging Het
Ccdc158 T C 5: 92,627,466 E960G probably benign Het
Ccdc80 T C 16: 45,096,710 S610P probably benign Het
Cdon T A 9: 35,455,408 Y193* probably null Het
Cept1 A T 3: 106,503,676 H400Q probably benign Het
Clspn T A 4: 126,590,641 N1197K probably benign Het
Cnot8 T C 11: 58,113,990 S172P probably damaging Het
Col14a1 T C 15: 55,520,008 I1794T probably damaging Het
Fam183b T C 11: 58,796,601 E66G probably damaging Het
Fam193a A T 5: 34,459,030 T564S possibly damaging Het
Galnt1 G A 18: 24,254,663 V154I probably benign Het
Gm14139 A G 2: 150,192,805 K349E probably damaging Het
Gstcd C A 3: 132,998,914 E526D probably benign Het
Ighv1-42 A C 12: 114,937,287 S59R probably benign Het
Morn3 A G 5: 123,046,760 C6R possibly damaging Het
Nrd1 A T 4: 109,044,585 K617M probably damaging Het
Olfr169 A G 16: 19,566,259 L208P probably damaging Het
Olfr632 A G 7: 103,938,193 H271R probably benign Het
Olfr883 T A 9: 38,026,466 I220N probably damaging Het
Olfr913 T C 9: 38,594,956 M245T probably benign Het
Pcdhb11 A G 18: 37,423,003 N462S probably damaging Het
Pfpl G T 19: 12,429,461 D359Y probably damaging Het
Phyhip T C 14: 70,461,859 V34A probably benign Het
Pigu A T 2: 155,297,196 I313N possibly damaging Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Psg16 T A 7: 17,095,166 F225Y possibly damaging Het
Setdb2 T A 14: 59,423,449 K82* probably null Het
Sgms1 A G 19: 32,124,425 S394P possibly damaging Het
Slc16a1 T C 3: 104,652,994 L205P probably benign Het
Slc19a1 T A 10: 77,044,769 I380N probably damaging Het
Snx32 A G 19: 5,498,014 I131T probably benign Het
Sorbs3 T C 14: 70,192,604 probably null Het
Stc2 T A 11: 31,360,392 I215L probably benign Het
Tln2 C T 9: 67,323,020 A84T probably damaging Het
Tomm34 A G 2: 164,060,991 M133T probably benign Het
Usp43 A G 11: 67,879,907 S634P probably benign Het
Vmn2r59 T A 7: 42,012,325 R689* probably null Het
Vmn2r9 C T 5: 108,845,036 R536Q probably benign Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Zfhx2 T A 14: 55,068,310 probably null Het
Zfp608 G T 18: 54,987,872 H214Q possibly damaging Het
Zfp619 T C 7: 39,535,134 V196A probably benign Het
Other mutations in Adgrl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Adgrl4 APN 3 151542841 missense probably damaging 1.00
IGL00694:Adgrl4 APN 3 151439396 splice site probably benign
IGL01143:Adgrl4 APN 3 151500229 splice site probably null
IGL01359:Adgrl4 APN 3 151543286 missense probably damaging 1.00
IGL01947:Adgrl4 APN 3 151510791 critical splice donor site probably null
IGL02149:Adgrl4 APN 3 151500354 missense possibly damaging 0.95
IGL02324:Adgrl4 APN 3 151497874 missense probably damaging 1.00
IGL02562:Adgrl4 APN 3 151439312 missense probably damaging 1.00
IGL02644:Adgrl4 APN 3 151492370 missense probably benign 0.00
trivial UTSW 3 151517610 missense probably benign 0.07
R0077:Adgrl4 UTSW 3 151517781 missense probably damaging 1.00
R0116:Adgrl4 UTSW 3 151517610 missense probably benign 0.07
R0331:Adgrl4 UTSW 3 151497940 missense probably benign 0.00
R0601:Adgrl4 UTSW 3 151498429 splice site probably benign
R0613:Adgrl4 UTSW 3 151543222 splice site probably benign
R1293:Adgrl4 UTSW 3 151507444 missense probably benign 0.00
R1463:Adgrl4 UTSW 3 151510596 missense probably damaging 0.98
R1697:Adgrl4 UTSW 3 151517611 missense probably damaging 1.00
R1731:Adgrl4 UTSW 3 151540986 missense possibly damaging 0.64
R1765:Adgrl4 UTSW 3 151543235 missense probably damaging 1.00
R1782:Adgrl4 UTSW 3 151542805 nonsense probably null
R1888:Adgrl4 UTSW 3 151439277 missense probably benign 0.11
R1888:Adgrl4 UTSW 3 151439277 missense probably benign 0.11
R1957:Adgrl4 UTSW 3 151510779 missense possibly damaging 0.94
R2128:Adgrl4 UTSW 3 151500201 missense probably benign 0.00
R2180:Adgrl4 UTSW 3 151500142 missense probably damaging 0.96
R2238:Adgrl4 UTSW 3 151500142 missense probably damaging 0.96
R2474:Adgrl4 UTSW 3 151542724 missense probably benign 0.01
R2697:Adgrl4 UTSW 3 151510623 missense probably damaging 1.00
R3835:Adgrl4 UTSW 3 151510617 missense probably damaging 1.00
R4499:Adgrl4 UTSW 3 151510785 missense possibly damaging 0.81
R4640:Adgrl4 UTSW 3 151500310 unclassified probably benign
R4747:Adgrl4 UTSW 3 151507440 missense probably benign 0.01
R5428:Adgrl4 UTSW 3 151542686 missense probably damaging 1.00
R5510:Adgrl4 UTSW 3 151497830 missense possibly damaging 0.89
R5717:Adgrl4 UTSW 3 151492334 missense probably benign 0.01
R6343:Adgrl4 UTSW 3 151517806 missense probably damaging 1.00
R6419:Adgrl4 UTSW 3 151439316 missense probably damaging 1.00
R6468:Adgrl4 UTSW 3 151492375 missense probably benign
R6636:Adgrl4 UTSW 3 151517773 nonsense probably null
R6637:Adgrl4 UTSW 3 151517773 nonsense probably null
R6687:Adgrl4 UTSW 3 151542755 missense probably benign 0.00
R6856:Adgrl4 UTSW 3 151500118 missense probably benign 0.00
R6887:Adgrl4 UTSW 3 151542733 missense possibly damaging 0.46
R7041:Adgrl4 UTSW 3 151439322 missense probably benign 0.00
R7527:Adgrl4 UTSW 3 151439250 missense probably benign 0.08
X0053:Adgrl4 UTSW 3 151497833 missense probably damaging 1.00
Z1088:Adgrl4 UTSW 3 151500175 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCAAAGTCCCTGACACTG -3'
(R):5'- CCCCAGAGCTGTCAGAAAATG -3'

Sequencing Primer
(F):5'- ACCAACCATGCAATTTACTTGTC -3'
(R):5'- CCCCAGAGCTGTCAGAAAATGAAAAG -3'
Posted On2017-08-16