Incidental Mutation 'R6106:Olfr913'
ID485513
Institutional Source Beutler Lab
Gene Symbol Olfr913
Ensembl Gene ENSMUSG00000059189
Gene Nameolfactory receptor 913
SynonymsMOR165-9P, GA_x6K02T2PVTD-32296575-32297513, MOR165-10
MMRRC Submission 044256-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R6106 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location38592759-38596283 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38594956 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 245 (M245T)
Ref Sequence ENSEMBL: ENSMUSP00000079876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081095]
Predicted Effect probably benign
Transcript: ENSMUST00000081095
AA Change: M245T

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000079876
Gene: ENSMUSG00000059189
AA Change: M245T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.6e-49 PFAM
Pfam:7tm_1 41 290 3.9e-23 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,613,412 T1105A possibly damaging Het
Ace A G 11: 105,989,012 E726G probably damaging Het
Adgrl4 A G 3: 151,540,985 I641V possibly damaging Het
Apoa5 A T 9: 46,270,633 R336* probably null Het
Bfsp2 T A 9: 103,479,824 T135S probably benign Het
Calhm2 A T 19: 47,133,062 Y223N probably damaging Het
Ccdc158 T C 5: 92,627,466 E960G probably benign Het
Ccdc80 T C 16: 45,096,710 S610P probably benign Het
Cdon T A 9: 35,455,408 Y193* probably null Het
Cept1 A T 3: 106,503,676 H400Q probably benign Het
Clspn T A 4: 126,590,641 N1197K probably benign Het
Cnot8 T C 11: 58,113,990 S172P probably damaging Het
Col14a1 T C 15: 55,520,008 I1794T probably damaging Het
Fam183b T C 11: 58,796,601 E66G probably damaging Het
Fam193a A T 5: 34,459,030 T564S possibly damaging Het
Galnt1 G A 18: 24,254,663 V154I probably benign Het
Gm14139 A G 2: 150,192,805 K349E probably damaging Het
Gstcd C A 3: 132,998,914 E526D probably benign Het
Ighv1-42 A C 12: 114,937,287 S59R probably benign Het
Morn3 A G 5: 123,046,760 C6R possibly damaging Het
Nrd1 A T 4: 109,044,585 K617M probably damaging Het
Olfr169 A G 16: 19,566,259 L208P probably damaging Het
Olfr632 A G 7: 103,938,193 H271R probably benign Het
Olfr883 T A 9: 38,026,466 I220N probably damaging Het
Pcdhb11 A G 18: 37,423,003 N462S probably damaging Het
Pfpl G T 19: 12,429,461 D359Y probably damaging Het
Phyhip T C 14: 70,461,859 V34A probably benign Het
Pigu A T 2: 155,297,196 I313N possibly damaging Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Psg16 T A 7: 17,095,166 F225Y possibly damaging Het
Setdb2 T A 14: 59,423,449 K82* probably null Het
Sgms1 A G 19: 32,124,425 S394P possibly damaging Het
Slc16a1 T C 3: 104,652,994 L205P probably benign Het
Slc19a1 T A 10: 77,044,769 I380N probably damaging Het
Snx32 A G 19: 5,498,014 I131T probably benign Het
Sorbs3 T C 14: 70,192,604 probably null Het
Stc2 T A 11: 31,360,392 I215L probably benign Het
Tln2 C T 9: 67,323,020 A84T probably damaging Het
Tomm34 A G 2: 164,060,991 M133T probably benign Het
Usp43 A G 11: 67,879,907 S634P probably benign Het
Vmn2r59 T A 7: 42,012,325 R689* probably null Het
Vmn2r9 C T 5: 108,845,036 R536Q probably benign Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Zfhx2 T A 14: 55,068,310 probably null Het
Zfp608 G T 18: 54,987,872 H214Q possibly damaging Het
Zfp619 T C 7: 39,535,134 V196A probably benign Het
Other mutations in Olfr913
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Olfr913 APN 9 38594905 missense probably damaging 0.98
IGL02028:Olfr913 APN 9 38594419 nonsense probably null
IGL02256:Olfr913 APN 9 38594544 missense probably benign 0.01
IGL03103:Olfr913 APN 9 38594527 missense probably damaging 1.00
IGL03297:Olfr913 APN 9 38594525 missense probably benign 0.01
R2152:Olfr913 UTSW 9 38594411 missense probably damaging 1.00
R2153:Olfr913 UTSW 9 38594411 missense probably damaging 1.00
R2154:Olfr913 UTSW 9 38594411 missense probably damaging 1.00
R3176:Olfr913 UTSW 9 38594643 missense probably damaging 1.00
R3276:Olfr913 UTSW 9 38594643 missense probably damaging 1.00
R4985:Olfr913 UTSW 9 38594362 missense possibly damaging 0.88
R5043:Olfr913 UTSW 9 38594841 missense probably damaging 1.00
R5871:Olfr913 UTSW 9 38594332 missense possibly damaging 0.53
R6583:Olfr913 UTSW 9 38594964 missense possibly damaging 0.79
R6823:Olfr913 UTSW 9 38594905 missense possibly damaging 0.89
R7472:Olfr913 UTSW 9 38594904 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CTGCAAATCTCCTGTACCAGC -3'
(R):5'- TAAGTGTAGGCTCAGAGATATCCAG -3'

Sequencing Primer
(F):5'- GCACCTATATCAATGAGATAGAGCTG -3'
(R):5'- CAAAGTCTTTCTCAGGGCAGC -3'
Posted On2017-08-16