Incidental Mutation 'R6106:Tln2'
ID485515
Institutional Source Beutler Lab
Gene Symbol Tln2
Ensembl Gene ENSMUSG00000052698
Gene Nametalin 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.407) question?
Stock #R6106 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location67217087-67559703 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 67323020 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 84 (A84T)
Ref Sequence ENSEMBL: ENSMUSP00000149284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039662] [ENSMUST00000040025] [ENSMUST00000215267] [ENSMUST00000215784] [ENSMUST00000217550]
Predicted Effect probably benign
Transcript: ENSMUST00000039662
AA Change: A1174T

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000035272
Gene: ENSMUSG00000052698
AA Change: A1174T

DomainStartEndE-ValueType
B41 84 316 1.29e-66 SMART
IRS 311 404 6.31e-17 SMART
Pfam:Talin_middle 494 655 3.4e-59 PFAM
Pfam:I_LWEQ 661 765 1.9e-10 PFAM
low complexity region 770 778 N/A INTRINSIC
PDB:2L7A|A 797 901 3e-44 PDB
low complexity region 902 918 N/A INTRINSIC
low complexity region 923 946 N/A INTRINSIC
internal_repeat_4 973 1033 7.18e-6 PROSPERO
internal_repeat_3 1083 1210 3.53e-6 PROSPERO
internal_repeat_4 1138 1198 7.18e-6 PROSPERO
low complexity region 1313 1325 N/A INTRINSIC
low complexity region 1330 1343 N/A INTRINSIC
internal_repeat_1 1482 1554 2.88e-9 PROSPERO
internal_repeat_2 1491 1551 2.05e-7 PROSPERO
low complexity region 1679 1690 N/A INTRINSIC
Pfam:VBS 1850 1974 2.6e-67 PFAM
internal_repeat_3 2010 2138 3.53e-6 PROSPERO
low complexity region 2309 2325 N/A INTRINSIC
low complexity region 2349 2359 N/A INTRINSIC
Pfam:I_LWEQ 2384 2531 2.5e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000040025
AA Change: A1174T

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000039633
Gene: ENSMUSG00000052698
AA Change: A1174T

DomainStartEndE-ValueType
B41 84 316 1.29e-66 SMART
IRS 311 404 6.31e-17 SMART
Pfam:Talin_middle 494 655 8.5e-78 PFAM
low complexity region 674 693 N/A INTRINSIC
internal_repeat_2 703 763 2.05e-7 PROSPERO
low complexity region 770 778 N/A INTRINSIC
PDB:2L7A|A 797 901 3e-44 PDB
low complexity region 902 918 N/A INTRINSIC
low complexity region 923 946 N/A INTRINSIC
internal_repeat_4 973 1033 7.18e-6 PROSPERO
internal_repeat_3 1083 1210 3.53e-6 PROSPERO
internal_repeat_4 1138 1198 7.18e-6 PROSPERO
low complexity region 1313 1325 N/A INTRINSIC
low complexity region 1330 1343 N/A INTRINSIC
internal_repeat_1 1482 1554 2.88e-9 PROSPERO
internal_repeat_2 1491 1551 2.05e-7 PROSPERO
low complexity region 1679 1690 N/A INTRINSIC
Pfam:VBS 1850 1974 9.9e-72 PFAM
internal_repeat_3 2010 2138 3.53e-6 PROSPERO
low complexity region 2309 2325 N/A INTRINSIC
low complexity region 2349 2359 N/A INTRINSIC
Pfam:I_LWEQ 2383 2533 4.3e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215267
AA Change: A84T

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000215784
AA Change: A1176T

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217550
AA Change: A88T

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein related to talin 1, a cytoskeletal protein that plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. This protein has a different pattern of expression compared to talin 1 but, like talin 1, is thought to associate with unique transmembrane receptors to form novel linkages between extracellular matrices and the actin cytoskeleton. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal muscle morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,613,412 T1105A possibly damaging Het
Ace A G 11: 105,989,012 E726G probably damaging Het
Adgrl4 A G 3: 151,540,985 I641V possibly damaging Het
Apoa5 A T 9: 46,270,633 R336* probably null Het
Bfsp2 T A 9: 103,479,824 T135S probably benign Het
Calhm2 A T 19: 47,133,062 Y223N probably damaging Het
Ccdc158 T C 5: 92,627,466 E960G probably benign Het
Ccdc80 T C 16: 45,096,710 S610P probably benign Het
Cdon T A 9: 35,455,408 Y193* probably null Het
Cept1 A T 3: 106,503,676 H400Q probably benign Het
Clspn T A 4: 126,590,641 N1197K probably benign Het
Cnot8 T C 11: 58,113,990 S172P probably damaging Het
Col14a1 T C 15: 55,520,008 I1794T probably damaging Het
Fam183b T C 11: 58,796,601 E66G probably damaging Het
Fam193a A T 5: 34,459,030 T564S possibly damaging Het
Galnt1 G A 18: 24,254,663 V154I probably benign Het
Gm14139 A G 2: 150,192,805 K349E probably damaging Het
Gstcd C A 3: 132,998,914 E526D probably benign Het
Ighv1-42 A C 12: 114,937,287 S59R probably benign Het
Morn3 A G 5: 123,046,760 C6R possibly damaging Het
Nrd1 A T 4: 109,044,585 K617M probably damaging Het
Olfr169 A G 16: 19,566,259 L208P probably damaging Het
Olfr632 A G 7: 103,938,193 H271R probably benign Het
Olfr883 T A 9: 38,026,466 I220N probably damaging Het
Olfr913 T C 9: 38,594,956 M245T probably benign Het
Pcdhb11 A G 18: 37,423,003 N462S probably damaging Het
Pfpl G T 19: 12,429,461 D359Y probably damaging Het
Phyhip T C 14: 70,461,859 V34A probably benign Het
Pigu A T 2: 155,297,196 I313N possibly damaging Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Psg16 T A 7: 17,095,166 F225Y possibly damaging Het
Setdb2 T A 14: 59,423,449 K82* probably null Het
Sgms1 A G 19: 32,124,425 S394P possibly damaging Het
Slc16a1 T C 3: 104,652,994 L205P probably benign Het
Slc19a1 T A 10: 77,044,769 I380N probably damaging Het
Snx32 A G 19: 5,498,014 I131T probably benign Het
Sorbs3 T C 14: 70,192,604 probably null Het
Stc2 T A 11: 31,360,392 I215L probably benign Het
Tomm34 A G 2: 164,060,991 M133T probably benign Het
Usp43 A G 11: 67,879,907 S634P probably benign Het
Vmn2r59 T A 7: 42,012,325 R689* probably null Het
Vmn2r9 C T 5: 108,845,036 R536Q probably benign Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Zfhx2 T A 14: 55,068,310 probably null Het
Zfp608 G T 18: 54,987,872 H214Q possibly damaging Het
Zfp619 T C 7: 39,535,134 V196A probably benign Het
Other mutations in Tln2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Tln2 APN 9 67344187 missense possibly damaging 0.59
IGL01110:Tln2 APN 9 67250582 nonsense probably null
IGL01112:Tln2 APN 9 67311811 missense probably damaging 1.00
IGL01307:Tln2 APN 9 67395467 missense probably benign 0.25
IGL01374:Tln2 APN 9 67261923 missense probably damaging 1.00
IGL01625:Tln2 APN 9 67370623 missense probably damaging 1.00
IGL01865:Tln2 APN 9 67250614 nonsense probably null
IGL01999:Tln2 APN 9 67392505 missense possibly damaging 0.81
IGL02002:Tln2 APN 9 67356698 missense probably damaging 0.98
IGL02005:Tln2 APN 9 67392505 missense possibly damaging 0.81
IGL02015:Tln2 APN 9 67361439 splice site probably benign
IGL02368:Tln2 APN 9 67240810 splice site probably benign
IGL02444:Tln2 APN 9 67258592 splice site probably benign
IGL02646:Tln2 APN 9 67255996 missense probably benign 0.43
IGL02744:Tln2 APN 9 67229376 nonsense probably null
IGL02869:Tln2 APN 9 67221525 splice site probably benign
IGL02930:Tln2 APN 9 67393662 nonsense probably null
IGL03100:Tln2 APN 9 67295737 missense probably damaging 1.00
IGL03326:Tln2 APN 9 67334257 missense possibly damaging 0.67
R0047:Tln2 UTSW 9 67240672 splice site probably benign
R0047:Tln2 UTSW 9 67240672 splice site probably benign
R0107:Tln2 UTSW 9 67370706 missense probably damaging 1.00
R0494:Tln2 UTSW 9 67355197 missense probably benign 0.22
R0884:Tln2 UTSW 9 67370733 missense probably damaging 1.00
R0947:Tln2 UTSW 9 67295813 missense probably benign 0.08
R0989:Tln2 UTSW 9 67229454 missense probably damaging 1.00
R1195:Tln2 UTSW 9 67258566 missense probably damaging 0.96
R1195:Tln2 UTSW 9 67258566 missense probably damaging 0.96
R1195:Tln2 UTSW 9 67258566 missense probably damaging 0.96
R1486:Tln2 UTSW 9 67311839 missense probably damaging 1.00
R1527:Tln2 UTSW 9 67272668 missense possibly damaging 0.95
R1584:Tln2 UTSW 9 67296414 missense probably damaging 1.00
R1636:Tln2 UTSW 9 67306532 missense probably damaging 1.00
R1656:Tln2 UTSW 9 67227107 missense possibly damaging 0.81
R1707:Tln2 UTSW 9 67375807 missense probably benign 0.00
R1749:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1751:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1761:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1767:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1815:Tln2 UTSW 9 67229423 missense probably damaging 1.00
R1840:Tln2 UTSW 9 67342043 missense probably damaging 1.00
R1847:Tln2 UTSW 9 67362687 nonsense probably null
R1964:Tln2 UTSW 9 67342135 missense probably benign 0.00
R1968:Tln2 UTSW 9 67255901 missense probably damaging 1.00
R2036:Tln2 UTSW 9 67272704 missense possibly damaging 0.76
R2038:Tln2 UTSW 9 67397653 start codon destroyed probably benign 0.01
R2152:Tln2 UTSW 9 67302560 missense probably damaging 1.00
R2153:Tln2 UTSW 9 67302560 missense probably damaging 1.00
R2154:Tln2 UTSW 9 67302560 missense probably damaging 1.00
R2191:Tln2 UTSW 9 67355221 missense probably damaging 1.00
R2192:Tln2 UTSW 9 67355221 missense probably damaging 1.00
R2201:Tln2 UTSW 9 67375757 missense probably damaging 1.00
R3116:Tln2 UTSW 9 67355139 missense probably benign 0.10
R3151:Tln2 UTSW 9 67330547 critical splice donor site probably null
R3795:Tln2 UTSW 9 67255915 missense probably damaging 0.97
R3953:Tln2 UTSW 9 67370629 missense probably damaging 1.00
R4450:Tln2 UTSW 9 67344065 critical splice donor site probably null
R4685:Tln2 UTSW 9 67302572 missense probably damaging 1.00
R4688:Tln2 UTSW 9 67397653 start codon destroyed probably benign 0.01
R4696:Tln2 UTSW 9 67395461 missense probably damaging 1.00
R4697:Tln2 UTSW 9 67395461 missense probably damaging 1.00
R4700:Tln2 UTSW 9 67346527 missense probably benign 0.03
R4701:Tln2 UTSW 9 67346527 missense probably benign 0.03
R4741:Tln2 UTSW 9 67386555 critical splice donor site probably null
R4806:Tln2 UTSW 9 67331733 missense probably benign 0.29
R4807:Tln2 UTSW 9 67331733 missense probably benign 0.29
R4808:Tln2 UTSW 9 67331733 missense probably benign 0.29
R4967:Tln2 UTSW 9 67355125 missense probably damaging 0.97
R5061:Tln2 UTSW 9 67354468 missense probably benign
R5092:Tln2 UTSW 9 67256028 missense probably benign 0.13
R5093:Tln2 UTSW 9 67334314 missense probably benign 0.44
R5126:Tln2 UTSW 9 67258535 missense probably damaging 1.00
R5204:Tln2 UTSW 9 67354482 missense probably benign 0.00
R5236:Tln2 UTSW 9 67365923 missense probably damaging 0.99
R5287:Tln2 UTSW 9 67242359 missense probably damaging 1.00
R5568:Tln2 UTSW 9 67311865 missense probably damaging 1.00
R5571:Tln2 UTSW 9 67334320 missense possibly damaging 0.88
R5642:Tln2 UTSW 9 67296358 missense probably benign 0.01
R5711:Tln2 UTSW 9 67392547 missense probably benign 0.00
R5776:Tln2 UTSW 9 67258250 missense probably damaging 1.00
R5791:Tln2 UTSW 9 67386605 missense probably damaging 0.98
R5866:Tln2 UTSW 9 67266868 missense probably damaging 1.00
R5888:Tln2 UTSW 9 67229403 missense probably damaging 1.00
R5902:Tln2 UTSW 9 67362717 missense probably benign 0.02
R6175:Tln2 UTSW 9 67224081 missense probably damaging 1.00
R6385:Tln2 UTSW 9 67278129 missense probably benign 0.45
R6430:Tln2 UTSW 9 67272665 missense probably damaging 1.00
R6441:Tln2 UTSW 9 67272689 missense probably damaging 1.00
R6738:Tln2 UTSW 9 67386664 missense possibly damaging 0.91
R6776:Tln2 UTSW 9 67262905 missense probably damaging 1.00
R6794:Tln2 UTSW 9 67286558 missense probably benign 0.07
R6850:Tln2 UTSW 9 67258535 missense probably damaging 1.00
R6907:Tln2 UTSW 9 67397635 missense probably damaging 0.98
R6909:Tln2 UTSW 9 67392532 missense probably damaging 0.97
R6951:Tln2 UTSW 9 67258485 missense probably damaging 0.97
X0027:Tln2 UTSW 9 67376853 missense probably damaging 1.00
X0064:Tln2 UTSW 9 67348138 missense probably damaging 1.00
X0067:Tln2 UTSW 9 67370691 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGTCAGTCAGTCTTGCTACC -3'
(R):5'- ATCCAGTGGAGAGACTCTTAACAG -3'

Sequencing Primer
(F):5'- AGTCTTGCTACCACACACACTTTAG -3'
(R):5'- GGAGAGACTCTTAACAGGCTTTCC -3'
Posted On2017-08-16