Incidental Mutation 'R6106:Slc19a1'
ID485517
Institutional Source Beutler Lab
Gene Symbol Slc19a1
Ensembl Gene ENSMUSG00000001436
Gene Namesolute carrier family 19 (folate transporter), member 1
SynonymsRFC1, RFC-1, reduced folate carrier
MMRRC Submission 044256-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6106 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location77032241-77061002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 77044769 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 380 (I380N)
Ref Sequence ENSEMBL: ENSMUSP00000116784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105410] [ENSMUST00000130703] [ENSMUST00000132984] [ENSMUST00000133059] [ENSMUST00000136150] [ENSMUST00000136925] [ENSMUST00000144234]
Predicted Effect probably damaging
Transcript: ENSMUST00000105410
AA Change: I380N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101050
Gene: ENSMUSG00000001436
AA Change: I380N

DomainStartEndE-ValueType
Pfam:Folate_carrier 23 427 3e-167 PFAM
Pfam:MFS_1 66 406 2.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127249
Predicted Effect probably benign
Transcript: ENSMUST00000130703
SMART Domains Protein: ENSMUSP00000115658
Gene: ENSMUSG00000001436

DomainStartEndE-ValueType
Pfam:Folate_carrier 23 64 9.3e-15 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000131031
AA Change: I64N
SMART Domains Protein: ENSMUSP00000114884
Gene: ENSMUSG00000001436
AA Change: I64N

DomainStartEndE-ValueType
Pfam:Folate_carrier 1 112 1.3e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132984
SMART Domains Protein: ENSMUSP00000116657
Gene: ENSMUSG00000001436

DomainStartEndE-ValueType
Pfam:Folate_carrier 23 233 4.8e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133059
SMART Domains Protein: ENSMUSP00000120266
Gene: ENSMUSG00000001436

DomainStartEndE-ValueType
Pfam:Folate_carrier 23 70 7.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136150
SMART Domains Protein: ENSMUSP00000121237
Gene: ENSMUSG00000001436

DomainStartEndE-ValueType
Pfam:Folate_carrier 23 242 1.9e-89 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000136925
AA Change: I380N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119382
Gene: ENSMUSG00000001436
AA Change: I380N

DomainStartEndE-ValueType
Pfam:Folate_carrier 23 426 7.8e-163 PFAM
Pfam:MFS_1 66 405 4.4e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000144234
AA Change: I380N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116784
Gene: ENSMUSG00000001436
AA Change: I380N

DomainStartEndE-ValueType
Pfam:Folate_carrier 23 427 3e-167 PFAM
Pfam:MFS_1 66 406 2.6e-13 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane protein encoded by this gene is a transporter of folate and is involved in the regulation of intracellular concentrations of folate. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous null embryos die due to abnormalities of hematopoietic organs. Mutant mice may be partially rescued with maternal folic acid supplementation, but these mice still present with hematopoietic organ defects and show impaired development of urogenital structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,613,412 T1105A possibly damaging Het
Ace A G 11: 105,989,012 E726G probably damaging Het
Adgrl4 A G 3: 151,540,985 I641V possibly damaging Het
Apoa5 A T 9: 46,270,633 R336* probably null Het
Bfsp2 T A 9: 103,479,824 T135S probably benign Het
Calhm2 A T 19: 47,133,062 Y223N probably damaging Het
Ccdc158 T C 5: 92,627,466 E960G probably benign Het
Ccdc80 T C 16: 45,096,710 S610P probably benign Het
Cdon T A 9: 35,455,408 Y193* probably null Het
Cept1 A T 3: 106,503,676 H400Q probably benign Het
Clspn T A 4: 126,590,641 N1197K probably benign Het
Cnot8 T C 11: 58,113,990 S172P probably damaging Het
Col14a1 T C 15: 55,520,008 I1794T probably damaging Het
Fam183b T C 11: 58,796,601 E66G probably damaging Het
Fam193a A T 5: 34,459,030 T564S possibly damaging Het
Galnt1 G A 18: 24,254,663 V154I probably benign Het
Gm14139 A G 2: 150,192,805 K349E probably damaging Het
Gstcd C A 3: 132,998,914 E526D probably benign Het
Ighv1-42 A C 12: 114,937,287 S59R probably benign Het
Morn3 A G 5: 123,046,760 C6R possibly damaging Het
Nrd1 A T 4: 109,044,585 K617M probably damaging Het
Olfr169 A G 16: 19,566,259 L208P probably damaging Het
Olfr632 A G 7: 103,938,193 H271R probably benign Het
Olfr883 T A 9: 38,026,466 I220N probably damaging Het
Olfr913 T C 9: 38,594,956 M245T probably benign Het
Pcdhb11 A G 18: 37,423,003 N462S probably damaging Het
Pfpl G T 19: 12,429,461 D359Y probably damaging Het
Phyhip T C 14: 70,461,859 V34A probably benign Het
Pigu A T 2: 155,297,196 I313N possibly damaging Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Psg16 T A 7: 17,095,166 F225Y possibly damaging Het
Setdb2 T A 14: 59,423,449 K82* probably null Het
Sgms1 A G 19: 32,124,425 S394P possibly damaging Het
Slc16a1 T C 3: 104,652,994 L205P probably benign Het
Snx32 A G 19: 5,498,014 I131T probably benign Het
Sorbs3 T C 14: 70,192,604 probably null Het
Stc2 T A 11: 31,360,392 I215L probably benign Het
Tln2 C T 9: 67,323,020 A84T probably damaging Het
Tomm34 A G 2: 164,060,991 M133T probably benign Het
Usp43 A G 11: 67,879,907 S634P probably benign Het
Vmn2r59 T A 7: 42,012,325 R689* probably null Het
Vmn2r9 C T 5: 108,845,036 R536Q probably benign Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Zfhx2 T A 14: 55,068,310 probably null Het
Zfp608 G T 18: 54,987,872 H214Q possibly damaging Het
Zfp619 T C 7: 39,535,134 V196A probably benign Het
Other mutations in Slc19a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0112:Slc19a1 UTSW 10 77042165 missense probably benign 0.04
R0211:Slc19a1 UTSW 10 77038466 missense possibly damaging 0.92
R0419:Slc19a1 UTSW 10 77042908 missense probably damaging 1.00
R1459:Slc19a1 UTSW 10 77042535 nonsense probably null
R1725:Slc19a1 UTSW 10 77041838 missense probably benign 0.03
R2202:Slc19a1 UTSW 10 77041924 missense possibly damaging 0.71
R2203:Slc19a1 UTSW 10 77041924 missense possibly damaging 0.71
R2221:Slc19a1 UTSW 10 77042486 missense probably benign 0.00
R3861:Slc19a1 UTSW 10 77041975 missense possibly damaging 0.88
R3968:Slc19a1 UTSW 10 77041846 missense probably damaging 1.00
R5800:Slc19a1 UTSW 10 77042269 missense probably null 0.00
R6501:Slc19a1 UTSW 10 77049606 missense probably benign 0.11
R6992:Slc19a1 UTSW 10 77049706 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TGGGTAGATACAGGAGTCTCCC -3'
(R):5'- ATGGACCTGCAGTCTCTGTC -3'

Sequencing Primer
(F):5'- AGGAGTCTCCCTGGCTTG -3'
(R):5'- TGTCCCCTGACAGTGAAGCAC -3'
Posted On2017-08-16