Incidental Mutation 'R6106:Ace'
ID485522
Institutional Source Beutler Lab
Gene Symbol Ace
Ensembl Gene ENSMUSG00000020681
Gene Nameangiotensin I converting enzyme (peptidyl-dipeptidase A) 1
SynonymsCD143
MMRRC Submission 044256-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6106 (G1)
Quality Score213.009
Status Not validated
Chromosome11
Chromosomal Location105967945-105989964 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105989012 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 726 (E726G)
Ref Sequence ENSEMBL: ENSMUSP00000001964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001963] [ENSMUST00000001964]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001963
AA Change: E1306G

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000001963
Gene: ENSMUSG00000020681
AA Change: E1306G

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Peptidase_M2 45 628 7.1e-257 PFAM
Pfam:Peptidase_M2 648 1226 8.9e-261 PFAM
transmembrane domain 1264 1286 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000001964
AA Change: E726G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001964
Gene: ENSMUSG00000020681
AA Change: E726G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Peptidase_M2 59 653 N/A PFAM
transmembrane domain 684 706 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130673
Predicted Effect probably benign
Transcript: ENSMUST00000132280
SMART Domains Protein: ENSMUSP00000119826
Gene: ENSMUSG00000020681

DomainStartEndE-ValueType
Pfam:Peptidase_M2 1 395 2.4e-201 PFAM
Pfam:Peptidase_M2 415 993 1.4e-261 PFAM
low complexity region 999 1014 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152925
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme involved in catalyzing the conversion of angiotensin I into a physiologically active peptide angiotensin II. Angiotensin II is a potent vasopressor and aldosterone-stimulating peptide that controls blood pressure and fluid-electrolyte balance. This enzyme plays a key role in the renin-angiotensin system. Many studies have associated the presence or absence of a 287 bp Alu repeat element in this gene with the levels of circulating enzyme or cardiovascular pathophysiologies. Multiple alternatively spliced transcript variants encoding different isoforms have been identified, and two most abundant spliced variants encode the somatic form and the testicular form, respectively, that are equally active. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a number of different targeted mutations show variable phenotypes, including reduced systemic blood pressure, normocytic anemia, renal abnormalities, inability to concentrate urine, and reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,613,412 T1105A possibly damaging Het
Adgrl4 A G 3: 151,540,985 I641V possibly damaging Het
Apoa5 A T 9: 46,270,633 R336* probably null Het
Bfsp2 T A 9: 103,479,824 T135S probably benign Het
Calhm2 A T 19: 47,133,062 Y223N probably damaging Het
Ccdc158 T C 5: 92,627,466 E960G probably benign Het
Ccdc80 T C 16: 45,096,710 S610P probably benign Het
Cdon T A 9: 35,455,408 Y193* probably null Het
Cept1 A T 3: 106,503,676 H400Q probably benign Het
Clspn T A 4: 126,590,641 N1197K probably benign Het
Cnot8 T C 11: 58,113,990 S172P probably damaging Het
Col14a1 T C 15: 55,520,008 I1794T probably damaging Het
Fam183b T C 11: 58,796,601 E66G probably damaging Het
Fam193a A T 5: 34,459,030 T564S possibly damaging Het
Galnt1 G A 18: 24,254,663 V154I probably benign Het
Gm14139 A G 2: 150,192,805 K349E probably damaging Het
Gstcd C A 3: 132,998,914 E526D probably benign Het
Ighv1-42 A C 12: 114,937,287 S59R probably benign Het
Morn3 A G 5: 123,046,760 C6R possibly damaging Het
Nrd1 A T 4: 109,044,585 K617M probably damaging Het
Olfr169 A G 16: 19,566,259 L208P probably damaging Het
Olfr632 A G 7: 103,938,193 H271R probably benign Het
Olfr883 T A 9: 38,026,466 I220N probably damaging Het
Olfr913 T C 9: 38,594,956 M245T probably benign Het
Pcdhb11 A G 18: 37,423,003 N462S probably damaging Het
Pfpl G T 19: 12,429,461 D359Y probably damaging Het
Phyhip T C 14: 70,461,859 V34A probably benign Het
Pigu A T 2: 155,297,196 I313N possibly damaging Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Psg16 T A 7: 17,095,166 F225Y possibly damaging Het
Setdb2 T A 14: 59,423,449 K82* probably null Het
Sgms1 A G 19: 32,124,425 S394P possibly damaging Het
Slc16a1 T C 3: 104,652,994 L205P probably benign Het
Slc19a1 T A 10: 77,044,769 I380N probably damaging Het
Snx32 A G 19: 5,498,014 I131T probably benign Het
Sorbs3 T C 14: 70,192,604 probably null Het
Stc2 T A 11: 31,360,392 I215L probably benign Het
Tln2 C T 9: 67,323,020 A84T probably damaging Het
Tomm34 A G 2: 164,060,991 M133T probably benign Het
Usp43 A G 11: 67,879,907 S634P probably benign Het
Vmn2r59 T A 7: 42,012,325 R689* probably null Het
Vmn2r9 C T 5: 108,845,036 R536Q probably benign Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Zfhx2 T A 14: 55,068,310 probably null Het
Zfp608 G T 18: 54,987,872 H214Q possibly damaging Het
Zfp619 T C 7: 39,535,134 V196A probably benign Het
Other mutations in Ace
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Ace APN 11 105979550 missense probably benign 0.21
IGL01105:Ace APN 11 105972059 missense probably damaging 1.00
IGL01761:Ace APN 11 105979493 missense possibly damaging 0.70
IGL01888:Ace APN 11 105968944 missense probably benign
IGL02173:Ace APN 11 105988991 missense probably benign 0.04
IGL02179:Ace APN 11 105969789 missense probably benign 0.16
IGL02331:Ace APN 11 105971344 missense possibly damaging 0.61
IGL02333:Ace APN 11 105971447 missense probably benign
IGL02556:Ace APN 11 105972527 missense probably damaging 1.00
IGL02576:Ace APN 11 105974111 missense probably damaging 1.00
IGL03202:Ace APN 11 105976962 missense probably damaging 1.00
R0403:Ace UTSW 11 105973880 splice site probably null
R0709:Ace UTSW 11 105981538 missense probably damaging 0.97
R1555:Ace UTSW 11 105974901 intron probably null
R1603:Ace UTSW 11 105972099 missense probably benign 0.23
R1644:Ace UTSW 11 105985106 missense probably damaging 1.00
R1834:Ace UTSW 11 105986094 splice site probably benign
R2074:Ace UTSW 11 105976623 nonsense probably null
R3025:Ace UTSW 11 105974093 splice site probably null
R3176:Ace UTSW 11 105976702 missense probably null 1.00
R3276:Ace UTSW 11 105976702 missense probably null 1.00
R3977:Ace UTSW 11 105981838 missense possibly damaging 0.96
R4506:Ace UTSW 11 105976666 missense probably damaging 0.98
R4598:Ace UTSW 11 105981759 splice site probably null
R4914:Ace UTSW 11 105979597 missense probably damaging 1.00
R4968:Ace UTSW 11 105981853 missense possibly damaging 0.93
R5137:Ace UTSW 11 105974826 missense probably damaging 1.00
R5274:Ace UTSW 11 105968037 missense probably benign
R5332:Ace UTSW 11 105973879 critical splice donor site probably null
R5388:Ace UTSW 11 105988458 missense possibly damaging 0.85
R5425:Ace UTSW 11 105973428 missense probably damaging 1.00
R5640:Ace UTSW 11 105970685 missense probably damaging 1.00
R5838:Ace UTSW 11 105972880 missense probably benign 0.00
R6041:Ace UTSW 11 105975308 missense probably benign 0.27
R6083:Ace UTSW 11 105985267 nonsense probably null
R6225:Ace UTSW 11 105979619 missense possibly damaging 0.51
R6607:Ace UTSW 11 105972377 missense possibly damaging 0.82
R6918:Ace UTSW 11 105972943 missense probably damaging 1.00
R7330:Ace UTSW 11 105986061 missense probably damaging 1.00
X0018:Ace UTSW 11 105971384 missense probably damaging 1.00
X0063:Ace UTSW 11 105975638 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TCAATTTCCTGGGCCTGTAC -3'
(R):5'- ATTCACAGAGACTGGGCAGG -3'

Sequencing Primer
(F):5'- TGTACCTGGAGCCACAGCAG -3'
(R):5'- CAGGGAAGTCGGTGTTAGAC -3'
Posted On2017-08-16