Incidental Mutation 'R6106:Wdr24'
ID485531
Institutional Source Beutler Lab
Gene Symbol Wdr24
Ensembl Gene ENSMUSG00000025737
Gene NameWD repeat domain 24
Synonyms
MMRRC Submission 044256-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6106 (G1)
Quality Score197.009
Status Not validated
Chromosome17
Chromosomal Location25823627-25828730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25824605 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 134 (H134Y)
Ref Sequence ENSEMBL: ENSMUSP00000026833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026832] [ENSMUST00000026833] [ENSMUST00000045692] [ENSMUST00000123582] [ENSMUST00000133595]
Predicted Effect probably benign
Transcript: ENSMUST00000026832
SMART Domains Protein: ENSMUSP00000026832
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
JmjC 140 271 5.27e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000026833
AA Change: H134Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026833
Gene: ENSMUSG00000025737
AA Change: H134Y

DomainStartEndE-ValueType
Blast:WD40 19 53 6e-8 BLAST
WD40 68 103 2.13e1 SMART
WD40 109 149 5.77e-5 SMART
WD40 152 192 4.48e-2 SMART
WD40 196 236 1.48e-11 SMART
WD40 244 282 1.66e0 SMART
WD40 286 327 2.48e0 SMART
low complexity region 605 623 N/A INTRINSIC
Blast:RING 743 780 2e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000045692
SMART Domains Protein: ENSMUSP00000048562
Gene: ENSMUSG00000025738

DomainStartEndE-ValueType
low complexity region 49 65 N/A INTRINSIC
low complexity region 70 89 N/A INTRINSIC
Blast:FBOX 98 137 2e-14 BLAST
LRR 241 266 1.32e1 SMART
LRR 267 291 1.61e2 SMART
LRR 293 318 1.76e2 SMART
LRR 319 344 3.21e-4 SMART
LRR 345 370 7.67e-2 SMART
LRR 371 396 6.13e-1 SMART
LRR 421 446 3.52e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123582
SMART Domains Protein: ENSMUSP00000119840
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
low complexity region 158 172 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123692
Predicted Effect probably benign
Transcript: ENSMUST00000133595
SMART Domains Protein: ENSMUSP00000122744
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
transmembrane domain 55 74 N/A INTRINSIC
JmjC 185 316 5.27e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144589
Predicted Effect probably benign
Transcript: ENSMUST00000152434
SMART Domains Protein: ENSMUSP00000119378
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160829
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180868
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,613,412 T1105A possibly damaging Het
Ace A G 11: 105,989,012 E726G probably damaging Het
Adgrl4 A G 3: 151,540,985 I641V possibly damaging Het
Apoa5 A T 9: 46,270,633 R336* probably null Het
Bfsp2 T A 9: 103,479,824 T135S probably benign Het
Calhm2 A T 19: 47,133,062 Y223N probably damaging Het
Ccdc158 T C 5: 92,627,466 E960G probably benign Het
Ccdc80 T C 16: 45,096,710 S610P probably benign Het
Cdon T A 9: 35,455,408 Y193* probably null Het
Cept1 A T 3: 106,503,676 H400Q probably benign Het
Clspn T A 4: 126,590,641 N1197K probably benign Het
Cnot8 T C 11: 58,113,990 S172P probably damaging Het
Col14a1 T C 15: 55,520,008 I1794T probably damaging Het
Fam183b T C 11: 58,796,601 E66G probably damaging Het
Fam193a A T 5: 34,459,030 T564S possibly damaging Het
Galnt1 G A 18: 24,254,663 V154I probably benign Het
Gm14139 A G 2: 150,192,805 K349E probably damaging Het
Gstcd C A 3: 132,998,914 E526D probably benign Het
Ighv1-42 A C 12: 114,937,287 S59R probably benign Het
Morn3 A G 5: 123,046,760 C6R possibly damaging Het
Nrd1 A T 4: 109,044,585 K617M probably damaging Het
Olfr169 A G 16: 19,566,259 L208P probably damaging Het
Olfr632 A G 7: 103,938,193 H271R probably benign Het
Olfr883 T A 9: 38,026,466 I220N probably damaging Het
Olfr913 T C 9: 38,594,956 M245T probably benign Het
Pcdhb11 A G 18: 37,423,003 N462S probably damaging Het
Pfpl G T 19: 12,429,461 D359Y probably damaging Het
Phyhip T C 14: 70,461,859 V34A probably benign Het
Pigu A T 2: 155,297,196 I313N possibly damaging Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Psg16 T A 7: 17,095,166 F225Y possibly damaging Het
Setdb2 T A 14: 59,423,449 K82* probably null Het
Sgms1 A G 19: 32,124,425 S394P possibly damaging Het
Slc16a1 T C 3: 104,652,994 L205P probably benign Het
Slc19a1 T A 10: 77,044,769 I380N probably damaging Het
Snx32 A G 19: 5,498,014 I131T probably benign Het
Sorbs3 T C 14: 70,192,604 probably null Het
Stc2 T A 11: 31,360,392 I215L probably benign Het
Tln2 C T 9: 67,323,020 A84T probably damaging Het
Tomm34 A G 2: 164,060,991 M133T probably benign Het
Usp43 A G 11: 67,879,907 S634P probably benign Het
Vmn2r59 T A 7: 42,012,325 R689* probably null Het
Vmn2r9 C T 5: 108,845,036 R536Q probably benign Het
Zfhx2 T A 14: 55,068,310 probably null Het
Zfp608 G T 18: 54,987,872 H214Q possibly damaging Het
Zfp619 T C 7: 39,535,134 V196A probably benign Het
Other mutations in Wdr24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Wdr24 APN 17 25826621 missense probably benign 0.20
IGL01700:Wdr24 APN 17 25825828 missense probably damaging 1.00
IGL01763:Wdr24 APN 17 25826190 missense probably benign 0.20
IGL02567:Wdr24 APN 17 25824348 missense probably damaging 0.99
IGL03100:Wdr24 APN 17 25825707 missense possibly damaging 0.47
R0012:Wdr24 UTSW 17 25827113 missense probably benign
R0799:Wdr24 UTSW 17 25826128 missense probably damaging 1.00
R1015:Wdr24 UTSW 17 25828238 missense probably benign 0.12
R1276:Wdr24 UTSW 17 25827467 missense probably benign 0.02
R1297:Wdr24 UTSW 17 25827348 missense possibly damaging 0.90
R1934:Wdr24 UTSW 17 25824266 missense possibly damaging 0.89
R2030:Wdr24 UTSW 17 25826043 missense probably benign 0.38
R2069:Wdr24 UTSW 17 25826282 missense probably damaging 1.00
R2508:Wdr24 UTSW 17 25824299 missense possibly damaging 0.52
R4601:Wdr24 UTSW 17 25828207 unclassified probably null
R4604:Wdr24 UTSW 17 25828505 missense probably damaging 1.00
R4894:Wdr24 UTSW 17 25826127 missense probably damaging 1.00
R5068:Wdr24 UTSW 17 25825779 missense possibly damaging 0.77
R5088:Wdr24 UTSW 17 25828207 unclassified probably null
R5104:Wdr24 UTSW 17 25824591 missense probably damaging 1.00
R5498:Wdr24 UTSW 17 25824561 missense probably damaging 1.00
R5719:Wdr24 UTSW 17 25828340 critical splice donor site probably null
R5892:Wdr24 UTSW 17 25827986 missense probably benign 0.00
R5975:Wdr24 UTSW 17 25827128 missense probably benign 0.37
R6084:Wdr24 UTSW 17 25824530 missense probably damaging 0.99
R6114:Wdr24 UTSW 17 25824605 missense probably benign
R6116:Wdr24 UTSW 17 25824605 missense probably benign
R6165:Wdr24 UTSW 17 25826421 missense probably benign 0.18
R6175:Wdr24 UTSW 17 25826578 missense probably damaging 1.00
R6331:Wdr24 UTSW 17 25825676 missense possibly damaging 0.61
R6548:Wdr24 UTSW 17 25827925 missense probably damaging 0.99
R6984:Wdr24 UTSW 17 25828235 missense possibly damaging 0.93
R7485:Wdr24 UTSW 17 25826127 missense probably damaging 1.00
X0022:Wdr24 UTSW 17 25824272 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCAGTTCGTAGAGAAGCTG -3'
(R):5'- CTCTGATGGACACACATTTCAGC -3'

Sequencing Primer
(F):5'- CTCAACCTGAGCTGTGCTGATG -3'
(R):5'- GACACACATTTCAGCCTGCCTG -3'
Posted On2017-08-16