Incidental Mutation 'R6107:Znfx1'
ID485544
Institutional Source Beutler Lab
Gene Symbol Znfx1
Ensembl Gene ENSMUSG00000039501
Gene Namezinc finger, NFX1-type containing 1
Synonyms
MMRRC Submission 044257-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6107 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location167035793-167063015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 167037081 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 928 (F928I)
Ref Sequence ENSEMBL: ENSMUSP00000072867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018143] [ENSMUST00000048988] [ENSMUST00000067584]
Predicted Effect probably benign
Transcript: ENSMUST00000018143
SMART Domains Protein: ENSMUSP00000018143
Gene: ENSMUSG00000017999

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
coiled coil region 78 106 N/A INTRINSIC
low complexity region 133 148 N/A INTRINSIC
low complexity region 157 166 N/A INTRINSIC
DEXDc 203 404 2.24e-56 SMART
HELICc 443 524 1.71e-29 SMART
coiled coil region 577 613 N/A INTRINSIC
low complexity region 622 629 N/A INTRINSIC
low complexity region 644 657 N/A INTRINSIC
low complexity region 679 692 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000048988
AA Change: F1792I

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000049404
Gene: ENSMUSG00000039501
AA Change: F1792I

DomainStartEndE-ValueType
Pfam:AAA_11 590 855 2.2e-17 PFAM
Pfam:AAA_19 597 684 1.7e-10 PFAM
Pfam:AAA_11 829 1033 1.4e-18 PFAM
Pfam:AAA_12 1044 1228 3.7e-42 PFAM
internal_repeat_2 1281 1374 1.33e-7 PROSPERO
internal_repeat_1 1292 1410 1.32e-16 PROSPERO
low complexity region 1422 1433 N/A INTRINSIC
internal_repeat_1 1434 1547 1.32e-16 PROSPERO
internal_repeat_2 1453 1555 1.33e-7 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000067584
AA Change: F928I

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000072867
Gene: ENSMUSG00000039501
AA Change: F928I

DomainStartEndE-ValueType
Pfam:AAA_11 8 170 1.2e-17 PFAM
Pfam:AAA_12 180 364 7.4e-42 PFAM
internal_repeat_2 417 510 1.08e-6 PROSPERO
internal_repeat_1 428 546 1.81e-14 PROSPERO
low complexity region 558 569 N/A INTRINSIC
internal_repeat_1 570 683 1.81e-14 PROSPERO
internal_repeat_2 589 691 1.08e-6 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127468
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrl3 A G 5: 81,688,563 R723G probably damaging Het
Ankrd52 C A 10: 128,387,012 N610K probably benign Het
Atp2a3 A G 11: 72,988,461 probably null Het
Bahcc1 G A 11: 120,272,888 A671T probably benign Het
Col6a5 A T 9: 105,892,272 Y1764* probably null Het
E2f8 A G 7: 48,867,676 V793A probably benign Het
Erbin A G 13: 103,833,892 I1072T probably benign Het
Exoc2 T C 13: 30,876,797 I575V probably benign Het
Fbxw19 C T 9: 109,495,766 V28M probably damaging Het
Flt1 G A 5: 147,603,593 T762M probably benign Het
Ghitm C A 14: 37,125,209 A303S probably damaging Het
Gm18856 T A 13: 13,965,734 probably benign Het
Gm5493 T A 17: 22,748,096 H68Q possibly damaging Het
Hells T G 19: 38,953,649 I461S probably benign Het
Inpp4a T A 1: 37,377,748 I450N probably damaging Het
Kbtbd6 T A 14: 79,453,113 V353D probably damaging Het
Kifap3 A T 1: 163,868,769 T656S possibly damaging Het
Med23 A T 10: 24,906,034 K713* probably null Het
Miga1 A T 3: 152,335,399 F44I probably benign Het
Ngrn A G 7: 80,261,877 E74G probably damaging Het
Olfr1286 T C 2: 111,420,655 S99G probably benign Het
Patl2 A T 2: 122,127,486 L97Q probably damaging Het
Pcdha1 A G 18: 36,932,301 I673V probably benign Het
Pcsk1 A G 13: 75,127,848 T543A probably benign Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Prl8a8 A G 13: 27,511,464 V100A possibly damaging Het
Rnase10 T A 14: 51,009,294 V43E possibly damaging Het
Robo1 A G 16: 72,983,829 S816G probably benign Het
Slc25a34 C T 4: 141,623,495 V68M probably benign Het
Slc25a48 A T 13: 56,465,078 E263V probably damaging Het
Slc7a14 A G 3: 31,257,610 V87A probably damaging Het
Slc8b1 A G 5: 120,529,600 I433V probably damaging Het
Smurf1 A G 5: 144,894,504 V259A possibly damaging Het
Spag6l T A 16: 16,781,788 N270I possibly damaging Het
Tas2r113 G A 6: 132,893,014 V2M probably damaging Het
Tnpo2 T C 8: 85,053,475 V680A probably damaging Het
Ttyh3 A C 5: 140,633,562 probably null Het
Ufl1 A G 4: 25,251,999 S639P possibly damaging Het
Other mutations in Znfx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Znfx1 APN 2 167036729 missense possibly damaging 0.65
IGL00492:Znfx1 APN 2 167036923 missense probably damaging 1.00
IGL01285:Znfx1 APN 2 167038695 missense possibly damaging 0.76
IGL01343:Znfx1 APN 2 167037363 missense probably benign 0.16
IGL01767:Znfx1 APN 2 167055723 missense probably damaging 1.00
IGL01983:Znfx1 APN 2 167056350 missense probably damaging 1.00
IGL02006:Znfx1 APN 2 167055763 missense probably damaging 1.00
IGL02254:Znfx1 APN 2 167055723 missense probably damaging 1.00
IGL02421:Znfx1 APN 2 167060080 missense probably damaging 0.97
IGL02496:Znfx1 APN 2 167047630 missense possibly damaging 0.83
IGL02525:Znfx1 APN 2 167037537 missense probably benign 0.00
IGL02528:Znfx1 APN 2 167050404 missense probably benign 0.11
IGL02537:Znfx1 APN 2 167056167 missense probably benign 0.37
IGL03065:Znfx1 APN 2 167055765 missense probably benign 0.00
R0127:Znfx1 UTSW 2 167044210 missense possibly damaging 0.84
R0331:Znfx1 UTSW 2 167046978 missense probably benign 0.11
R0488:Znfx1 UTSW 2 167042563 missense possibly damaging 0.52
R0497:Znfx1 UTSW 2 167055411 missense probably benign 0.03
R0537:Znfx1 UTSW 2 167041701 missense probably damaging 1.00
R0542:Znfx1 UTSW 2 167055655 missense probably damaging 1.00
R0650:Znfx1 UTSW 2 167047654 nonsense probably null
R0655:Znfx1 UTSW 2 167056907 missense probably damaging 1.00
R1104:Znfx1 UTSW 2 167055640 nonsense probably null
R1470:Znfx1 UTSW 2 167042587 missense possibly damaging 0.91
R1470:Znfx1 UTSW 2 167042587 missense possibly damaging 0.91
R1512:Znfx1 UTSW 2 167056317 missense probably benign 0.03
R1533:Znfx1 UTSW 2 167056788 missense probably benign 0.10
R1541:Znfx1 UTSW 2 167056190 missense probably damaging 0.99
R1642:Znfx1 UTSW 2 167039010 missense possibly damaging 0.95
R1720:Znfx1 UTSW 2 167044066 nonsense probably null
R1760:Znfx1 UTSW 2 167039866 missense probably damaging 0.96
R1865:Znfx1 UTSW 2 167038809 missense probably damaging 1.00
R1959:Znfx1 UTSW 2 167050350 missense probably damaging 1.00
R2088:Znfx1 UTSW 2 167055810 missense probably damaging 1.00
R4581:Znfx1 UTSW 2 167050316 missense probably damaging 1.00
R4622:Znfx1 UTSW 2 167041753 missense possibly damaging 0.91
R4649:Znfx1 UTSW 2 167056356 missense probably benign 0.08
R4685:Znfx1 UTSW 2 167039030 missense probably damaging 1.00
R4798:Znfx1 UTSW 2 167038569 unclassified probably null
R4827:Znfx1 UTSW 2 167044231 missense possibly damaging 0.77
R4870:Znfx1 UTSW 2 167055269 missense probably benign
R4910:Znfx1 UTSW 2 167036804 missense probably damaging 1.00
R4910:Znfx1 UTSW 2 167037482 missense probably benign 0.00
R5022:Znfx1 UTSW 2 167039826 missense probably damaging 1.00
R5023:Znfx1 UTSW 2 167039826 missense probably damaging 1.00
R5057:Znfx1 UTSW 2 167039826 missense probably damaging 1.00
R5061:Znfx1 UTSW 2 167065398 unclassified probably benign
R5119:Znfx1 UTSW 2 167065387 unclassified probably benign
R5125:Znfx1 UTSW 2 167046939 missense possibly damaging 0.81
R5896:Znfx1 UTSW 2 167039000 missense probably damaging 1.00
R6112:Znfx1 UTSW 2 167038206 missense probably benign
R6158:Znfx1 UTSW 2 167056726 missense probably benign 0.19
R6281:Znfx1 UTSW 2 167055885 missense probably damaging 1.00
R6464:Znfx1 UTSW 2 167046922 missense probably benign 0.34
R6749:Znfx1 UTSW 2 167056599 missense probably benign 0.00
R6888:Znfx1 UTSW 2 167038940 missense possibly damaging 0.91
R6973:Znfx1 UTSW 2 167056761 missense probably benign 0.18
R7017:Znfx1 UTSW 2 167048534 missense probably damaging 1.00
R7138:Znfx1 UTSW 2 167056777 missense probably benign 0.03
R7192:Znfx1 UTSW 2 167042190 missense probably benign 0.00
X0064:Znfx1 UTSW 2 167055256 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACATAGATGTGGCCATTGGG -3'
(R):5'- GGTGCATTGTGGAGAACAGC -3'

Sequencing Primer
(F):5'- TTGGGGCACTTGAACCAATGC -3'
(R):5'- ACTTGAGCAGGTCCACGAGTG -3'
Posted On2017-08-16