Incidental Mutation 'R6107:Slc25a34'
ID485550
Institutional Source Beutler Lab
Gene Symbol Slc25a34
Ensembl Gene ENSMUSG00000040740
Gene Namesolute carrier family 25, member 34
SynonymsLOC384071
MMRRC Submission 044257-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R6107 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location141618824-141623821 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 141623495 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 68 (V68M)
Ref Sequence ENSEMBL: ENSMUSP00000039188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030751] [ENSMUST00000038661] [ENSMUST00000084203] [ENSMUST00000143154]
Predicted Effect probably benign
Transcript: ENSMUST00000030751
SMART Domains Protein: ENSMUSP00000030751
Gene: ENSMUSG00000028917

DomainStartEndE-ValueType
RUN 93 156 3.18e-21 SMART
low complexity region 230 246 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
low complexity region 485 495 N/A INTRINSIC
low complexity region 505 538 N/A INTRINSIC
Blast:PH 596 656 7e-31 BLAST
PH 766 869 2.43e-12 SMART
Blast:PH 879 960 6e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000038661
AA Change: V68M

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000039188
Gene: ENSMUSG00000040740
AA Change: V68M

DomainStartEndE-ValueType
Pfam:Mito_carr 16 111 2.2e-14 PFAM
Pfam:Mito_carr 113 213 7.6e-18 PFAM
Pfam:Mito_carr 217 314 9.3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084203
SMART Domains Protein: ENSMUSP00000081221
Gene: ENSMUSG00000028917

DomainStartEndE-ValueType
RUN 93 156 3.18e-21 SMART
low complexity region 250 266 N/A INTRINSIC
low complexity region 315 327 N/A INTRINSIC
low complexity region 479 489 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
low complexity region 525 558 N/A INTRINSIC
Blast:PH 616 676 7e-31 BLAST
PH 786 889 2.43e-12 SMART
Blast:PH 899 980 6e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136102
Predicted Effect probably benign
Transcript: ENSMUST00000143154
SMART Domains Protein: ENSMUSP00000120973
Gene: ENSMUSG00000043085

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
transmembrane domain 31 53 N/A INTRINSIC
transmembrane domain 74 96 N/A INTRINSIC
low complexity region 126 142 N/A INTRINSIC
transmembrane domain 144 166 N/A INTRINSIC
transmembrane domain 203 222 N/A INTRINSIC
transmembrane domain 232 249 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC25A34 belongs to the SLC25 family of mitochondrial carrier proteins (Haitina et al., 2006 [PubMed 16949250]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrl3 A G 5: 81,688,563 R723G probably damaging Het
Ankrd52 C A 10: 128,387,012 N610K probably benign Het
Atp2a3 A G 11: 72,988,461 probably null Het
Bahcc1 G A 11: 120,272,888 A671T probably benign Het
Col6a5 A T 9: 105,892,272 Y1764* probably null Het
E2f8 A G 7: 48,867,676 V793A probably benign Het
Erbin A G 13: 103,833,892 I1072T probably benign Het
Exoc2 T C 13: 30,876,797 I575V probably benign Het
Fbxw19 C T 9: 109,495,766 V28M probably damaging Het
Flt1 G A 5: 147,603,593 T762M probably benign Het
Ghitm C A 14: 37,125,209 A303S probably damaging Het
Gm18856 T A 13: 13,965,734 probably benign Het
Gm5493 T A 17: 22,748,096 H68Q possibly damaging Het
Hells T G 19: 38,953,649 I461S probably benign Het
Inpp4a T A 1: 37,377,748 I450N probably damaging Het
Kbtbd6 T A 14: 79,453,113 V353D probably damaging Het
Kifap3 A T 1: 163,868,769 T656S possibly damaging Het
Med23 A T 10: 24,906,034 K713* probably null Het
Miga1 A T 3: 152,335,399 F44I probably benign Het
Ngrn A G 7: 80,261,877 E74G probably damaging Het
Olfr1286 T C 2: 111,420,655 S99G probably benign Het
Patl2 A T 2: 122,127,486 L97Q probably damaging Het
Pcdha1 A G 18: 36,932,301 I673V probably benign Het
Pcsk1 A G 13: 75,127,848 T543A probably benign Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Prl8a8 A G 13: 27,511,464 V100A possibly damaging Het
Rnase10 T A 14: 51,009,294 V43E possibly damaging Het
Robo1 A G 16: 72,983,829 S816G probably benign Het
Slc25a48 A T 13: 56,465,078 E263V probably damaging Het
Slc7a14 A G 3: 31,257,610 V87A probably damaging Het
Slc8b1 A G 5: 120,529,600 I433V probably damaging Het
Smurf1 A G 5: 144,894,504 V259A possibly damaging Het
Spag6l T A 16: 16,781,788 N270I possibly damaging Het
Tas2r113 G A 6: 132,893,014 V2M probably damaging Het
Tnpo2 T C 8: 85,053,475 V680A probably damaging Het
Ttyh3 A C 5: 140,633,562 probably null Het
Ufl1 A G 4: 25,251,999 S639P possibly damaging Het
Znfx1 A T 2: 167,037,081 F928I possibly damaging Het
Other mutations in Slc25a34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Slc25a34 APN 4 141621436 missense possibly damaging 0.84
IGL01578:Slc25a34 APN 4 141622510 splice site probably null
IGL01694:Slc25a34 APN 4 141622253 missense probably benign 0.03
IGL02421:Slc25a34 APN 4 141621442 missense probably benign 0.00
R0139:Slc25a34 UTSW 4 141622352 missense possibly damaging 0.51
R0415:Slc25a34 UTSW 4 141620469 missense possibly damaging 0.48
R1851:Slc25a34 UTSW 4 141622268 missense probably benign 0.06
R1852:Slc25a34 UTSW 4 141622268 missense probably benign 0.06
R4776:Slc25a34 UTSW 4 141623588 missense possibly damaging 0.83
R5112:Slc25a34 UTSW 4 141621458 missense probably benign 0.01
R5426:Slc25a34 UTSW 4 141623566 missense probably damaging 0.96
R5807:Slc25a34 UTSW 4 141623662 missense probably benign
R6977:Slc25a34 UTSW 4 141620498 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGACACTTACCAGGTAAGCAG -3'
(R):5'- CCATGGATTCGAGGGAGATG -3'

Sequencing Primer
(F):5'- TTACCAGGTAAGCAGGACTCC -3'
(R):5'- ATTCGAGGGAGATGGTGTCC -3'
Posted On2017-08-16