Incidental Mutation 'R6108:Lmod1'
ID485583
Institutional Source Beutler Lab
Gene Symbol Lmod1
Ensembl Gene ENSMUSG00000048096
Gene Nameleiomodin 1 (smooth muscle)
SynonymsD1, 9530015K06Rik, 64kD D1, 1D, SM-Lmod
MMRRC Submission 044258-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6108 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location135324807-135368065 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 135364111 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 235 (G235R)
Ref Sequence ENSEMBL: ENSMUSP00000061597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059352]
Predicted Effect probably benign
Transcript: ENSMUST00000059352
AA Change: G235R

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000061597
Gene: ENSMUSG00000048096
AA Change: G235R

DomainStartEndE-ValueType
Pfam:Tropomodulin 5 127 1e-19 PFAM
low complexity region 177 190 N/A INTRINSIC
low complexity region 202 220 N/A INTRINSIC
PDB:1IO0|A 296 467 5e-35 PDB
SCOP:d1a4ya_ 311 445 7e-5 SMART
low complexity region 469 483 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
WH2 569 588 1.05e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The leiomodin 1 protein has a putative membrane-spanning region and 2 types of tandemly repeated blocks. The transcript is expressed in all tissues tested, with the highest levels in thyroid, eye muscle, skeletal muscle, and ovary. Increased expression of leiomodin 1 may be linked to Graves' disease and thyroid-associated ophthalmopathy. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A G 13: 81,391,695 F5702L probably damaging Het
Aptx G A 4: 40,694,986 Q117* probably null Het
Axin1 T A 17: 26,143,240 M186K probably damaging Het
Btbd2 A T 10: 80,645,531 L249Q probably damaging Het
Caprin1 C T 2: 103,776,017 V293I possibly damaging Het
Ccdc136 C A 6: 29,412,450 H334Q probably benign Het
Ccdc180 A G 4: 45,911,389 N568S possibly damaging Het
Cenpf A T 1: 189,662,013 F515L probably benign Het
Chrm2 T A 6: 36,523,295 V29E probably damaging Het
Cnot1 A G 8: 95,730,420 L1956P probably damaging Het
Cyp2d22 T C 15: 82,371,905 K176R possibly damaging Het
Dnah7a A T 1: 53,456,845 I3151N probably damaging Het
Dsg1a T A 18: 20,340,247 D792E probably benign Het
Fam167b A T 4: 129,578,308 L23* probably null Het
Fermt3 C A 19: 7,014,414 R143L probably benign Het
Gfm2 A G 13: 97,149,422 I140V possibly damaging Het
Gna14 A G 19: 16,603,343 T182A probably damaging Het
Hmcn1 A G 1: 150,631,227 V3738A possibly damaging Het
Hspa4 C T 11: 53,261,712 G810D probably damaging Het
Igf2bp3 A G 6: 49,117,374 I154T probably damaging Het
Il1rap G A 16: 26,722,707 S566N probably damaging Het
Kcnb1 G A 2: 167,105,140 T596M probably damaging Het
Kcnn1 A C 8: 70,855,156 S81A probably benign Het
Mei1 A T 15: 82,075,188 R185S possibly damaging Het
Mmrn1 G A 6: 60,975,976 V414M possibly damaging Het
Mon2 C A 10: 123,032,695 M484I probably benign Het
Nae1 A T 8: 104,527,402 D99E probably benign Het
Nsun7 T A 5: 66,295,799 I619N probably damaging Het
Nudt12 C A 17: 59,007,749 R280L probably damaging Het
Olfr365 T C 2: 37,201,766 V175A possibly damaging Het
P2ry1 T A 3: 61,004,175 I245N probably damaging Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Plek T A 11: 16,990,058 Y217F probably damaging Het
Plpp1 A T 13: 112,866,865 I208F possibly damaging Het
Ptges3-ps C T 6: 85,844,555 noncoding transcript Het
Ptprf A G 4: 118,223,256 L1267P probably benign Het
Ptprz1 A T 6: 23,045,659 S2143C probably damaging Het
Scn9a T C 2: 66,484,049 D1764G probably damaging Het
Serpinb5 T A 1: 106,881,728 L288Q probably damaging Het
Slc6a20b T G 9: 123,596,186 M539L probably benign Het
Slfnl1 A G 4: 120,533,361 T70A probably benign Het
Smtn C A 11: 3,529,608 L486F probably damaging Het
Sptbn2 G A 19: 4,731,392 probably null Het
Tas2r144 C A 6: 42,215,757 L144I possibly damaging Het
Tjp3 C T 10: 81,281,146 R183K probably benign Het
Tnip3 A G 6: 65,525,411 probably null Het
Tspan12 T A 6: 21,772,771 M212L probably benign Het
Ttn T A 2: 76,878,041 probably benign Het
Vmn1r71 T C 7: 10,748,618 M48V probably benign Het
Vmn2r10 A G 5: 108,995,801 F761S probably damaging Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Wdr72 A G 9: 74,151,668 T348A probably damaging Het
Xrn1 A T 9: 95,974,427 L333F possibly damaging Het
Other mutations in Lmod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Lmod1 APN 1 135364478 missense probably benign 0.05
IGL01104:Lmod1 APN 1 135364784 missense probably damaging 1.00
IGL02606:Lmod1 APN 1 135364480 missense probably benign 0.09
IGL03373:Lmod1 APN 1 135364526 missense possibly damaging 0.90
R0513:Lmod1 UTSW 1 135325168 missense probably damaging 0.98
R1185:Lmod1 UTSW 1 135364229 missense probably benign
R1185:Lmod1 UTSW 1 135364229 missense probably benign
R1185:Lmod1 UTSW 1 135364229 missense probably benign
R1572:Lmod1 UTSW 1 135363933 missense probably benign 0.00
R1728:Lmod1 UTSW 1 135364073 missense probably benign 0.10
R1729:Lmod1 UTSW 1 135364073 missense probably benign 0.10
R1730:Lmod1 UTSW 1 135364073 missense probably benign 0.10
R1739:Lmod1 UTSW 1 135364073 missense probably benign 0.10
R1762:Lmod1 UTSW 1 135364073 missense probably benign 0.10
R1783:Lmod1 UTSW 1 135364073 missense probably benign 0.10
R1784:Lmod1 UTSW 1 135364073 missense probably benign 0.10
R1785:Lmod1 UTSW 1 135364073 missense probably benign 0.10
R1795:Lmod1 UTSW 1 135325124 missense probably damaging 1.00
R2044:Lmod1 UTSW 1 135364387 missense probably benign 0.00
R2355:Lmod1 UTSW 1 135364515 missense probably benign 0.28
R2568:Lmod1 UTSW 1 135363964 nonsense probably null
R2937:Lmod1 UTSW 1 135363916 missense probably benign 0.11
R2938:Lmod1 UTSW 1 135363916 missense probably benign 0.11
R6823:Lmod1 UTSW 1 135325167 missense probably damaging 0.98
R6872:Lmod1 UTSW 1 135365141 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCATCAGAGGTATTGATAAAGGC -3'
(R):5'- ATATGCTGGGAGCTGCTTCC -3'

Sequencing Primer
(F):5'- TCAGAGGTATTGATAAAGGCAGGGTC -3'
(R):5'- TCTGGCTTGCCCATCAGAG -3'
Posted On2017-08-16