Incidental Mutation 'R6108:Axin1'
ID485628
Institutional Source Beutler Lab
Gene Symbol Axin1
Ensembl Gene ENSMUSG00000024182
Gene Nameaxin 1
Synonyms
MMRRC Submission 044258-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6108 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location26138688-26195811 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26143240 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 186 (M186K)
Ref Sequence ENSEMBL: ENSMUSP00000132000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074370] [ENSMUST00000118904] [ENSMUST00000163421] [ENSMUST00000168282]
Predicted Effect probably damaging
Transcript: ENSMUST00000074370
AA Change: M186K

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073974
Gene: ENSMUSG00000024182
AA Change: M186K

DomainStartEndE-ValueType
Pfam:AXIN1_TNKS_BD 13 85 7.5e-27 PFAM
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 523 3.2e-13 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
low complexity region 713 727 N/A INTRINSIC
DAX 786 868 5.92e-45 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118904
AA Change: M186K

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113756
Gene: ENSMUSG00000024182
AA Change: M186K

DomainStartEndE-ValueType
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 502 1.2e-18 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
coiled coil region 712 734 N/A INTRINSIC
DAX 750 832 5.92e-45 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163421
AA Change: M186K

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132000
Gene: ENSMUSG00000024182
AA Change: M186K

DomainStartEndE-ValueType
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 502 1.2e-18 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
coiled coil region 712 734 N/A INTRINSIC
DAX 750 832 5.92e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168282
SMART Domains Protein: ENSMUSP00000127182
Gene: ENSMUSG00000024182

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
coiled coil region 126 154 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which contains a regulation of G-protein signaling (RGS) domain and a dishevelled and axin (DIX) domain. The encoded protein interacts with adenomatosis polyposis coli, catenin beta-1, glycogen synthase kinase 3 beta, protein phosphate 2, and itself. This protein functions as a negative regulator of the wingless-type MMTV integration site family, member 1 (WNT) signaling pathway and can induce apoptosis. The crystal structure of a portion of this protein, alone and in a complex with other proteins, has been resolved. Mutations in this gene have been associated with hepatocellular carcinoma, hepatoblastomas, ovarian endometriod adenocarcinomas, and medullablastomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mutant homozygotes die at embryonic day 8-10, exhibiting neuroectodermal defects and axial duplications. Heterozygotes exhibit skeletal, cardiac, and neurological defects including short, bent tails, and deafness with circling behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A G 13: 81,391,695 F5702L probably damaging Het
Aptx G A 4: 40,694,986 Q117* probably null Het
Btbd2 A T 10: 80,645,531 L249Q probably damaging Het
Caprin1 C T 2: 103,776,017 V293I possibly damaging Het
Ccdc136 C A 6: 29,412,450 H334Q probably benign Het
Ccdc180 A G 4: 45,911,389 N568S possibly damaging Het
Cenpf A T 1: 189,662,013 F515L probably benign Het
Chrm2 T A 6: 36,523,295 V29E probably damaging Het
Cnot1 A G 8: 95,730,420 L1956P probably damaging Het
Cyp2d22 T C 15: 82,371,905 K176R possibly damaging Het
Dnah7a A T 1: 53,456,845 I3151N probably damaging Het
Dsg1a T A 18: 20,340,247 D792E probably benign Het
Fam167b A T 4: 129,578,308 L23* probably null Het
Fermt3 C A 19: 7,014,414 R143L probably benign Het
Gfm2 A G 13: 97,149,422 I140V possibly damaging Het
Gna14 A G 19: 16,603,343 T182A probably damaging Het
Hmcn1 A G 1: 150,631,227 V3738A possibly damaging Het
Hspa4 C T 11: 53,261,712 G810D probably damaging Het
Igf2bp3 A G 6: 49,117,374 I154T probably damaging Het
Il1rap G A 16: 26,722,707 S566N probably damaging Het
Kcnb1 G A 2: 167,105,140 T596M probably damaging Het
Kcnn1 A C 8: 70,855,156 S81A probably benign Het
Lmod1 G A 1: 135,364,111 G235R probably benign Het
Mei1 A T 15: 82,075,188 R185S possibly damaging Het
Mmrn1 G A 6: 60,975,976 V414M possibly damaging Het
Mon2 C A 10: 123,032,695 M484I probably benign Het
Nae1 A T 8: 104,527,402 D99E probably benign Het
Nsun7 T A 5: 66,295,799 I619N probably damaging Het
Nudt12 C A 17: 59,007,749 R280L probably damaging Het
Olfr365 T C 2: 37,201,766 V175A possibly damaging Het
P2ry1 T A 3: 61,004,175 I245N probably damaging Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Plek T A 11: 16,990,058 Y217F probably damaging Het
Plpp1 A T 13: 112,866,865 I208F possibly damaging Het
Ptges3-ps C T 6: 85,844,555 noncoding transcript Het
Ptprf A G 4: 118,223,256 L1267P probably benign Het
Ptprz1 A T 6: 23,045,659 S2143C probably damaging Het
Scn9a T C 2: 66,484,049 D1764G probably damaging Het
Serpinb5 T A 1: 106,881,728 L288Q probably damaging Het
Slc6a20b T G 9: 123,596,186 M539L probably benign Het
Slfnl1 A G 4: 120,533,361 T70A probably benign Het
Smtn C A 11: 3,529,608 L486F probably damaging Het
Sptbn2 G A 19: 4,731,392 probably null Het
Tas2r144 C A 6: 42,215,757 L144I possibly damaging Het
Tjp3 C T 10: 81,281,146 R183K probably benign Het
Tnip3 A G 6: 65,525,411 probably null Het
Tspan12 T A 6: 21,772,771 M212L probably benign Het
Ttn T A 2: 76,878,041 probably benign Het
Vmn1r71 T C 7: 10,748,618 M48V probably benign Het
Vmn2r10 A G 5: 108,995,801 F761S probably damaging Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Wdr72 A G 9: 74,151,668 T348A probably damaging Het
Xrn1 A T 9: 95,974,427 L333F possibly damaging Het
Other mutations in Axin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Axin1 APN 17 26142805 missense possibly damaging 0.88
IGL00229:Axin1 APN 17 26194072 missense probably damaging 1.00
IGL01141:Axin1 APN 17 26190041 missense probably damaging 0.98
IGL02088:Axin1 APN 17 26188695 missense probably benign 0.05
IGL02413:Axin1 APN 17 26188179 missense probably benign 0.00
R0331:Axin1 UTSW 17 26143107 missense probably damaging 1.00
R0454:Axin1 UTSW 17 26173663 missense probably benign 0.00
R0538:Axin1 UTSW 17 26184241 missense possibly damaging 0.66
R0755:Axin1 UTSW 17 26182506 missense possibly damaging 0.95
R0976:Axin1 UTSW 17 26188086 missense probably damaging 1.00
R1634:Axin1 UTSW 17 26187991 missense probably damaging 0.99
R1950:Axin1 UTSW 17 26193964 missense possibly damaging 0.62
R1965:Axin1 UTSW 17 26184225 missense probably damaging 1.00
R1965:Axin1 UTSW 17 26190228 missense probably damaging 0.97
R2180:Axin1 UTSW 17 26143335 missense probably benign
R3051:Axin1 UTSW 17 26190125 missense probably benign 0.01
R3413:Axin1 UTSW 17 26188038 missense probably damaging 0.99
R3849:Axin1 UTSW 17 26187797 missense probably benign 0.01
R4530:Axin1 UTSW 17 26188172 missense probably benign 0.09
R4560:Axin1 UTSW 17 26173771 missense probably damaging 1.00
R4764:Axin1 UTSW 17 26173756 missense possibly damaging 0.46
R4976:Axin1 UTSW 17 26194070 missense probably benign 0.42
R4976:Axin1 UTSW 17 26194071 missense probably benign 0.24
R5299:Axin1 UTSW 17 26173734 missense probably damaging 0.99
R5682:Axin1 UTSW 17 26187801 missense probably benign
R5690:Axin1 UTSW 17 26194937 missense probably damaging 1.00
R5722:Axin1 UTSW 17 26182557 missense probably damaging 1.00
R5793:Axin1 UTSW 17 26143308 missense probably damaging 1.00
R6282:Axin1 UTSW 17 26143037 missense probably damaging 1.00
R6490:Axin1 UTSW 17 26142994 missense probably damaging 1.00
R7153:Axin1 UTSW 17 26187968 missense probably benign
R7181:Axin1 UTSW 17 26173778 missense probably damaging 1.00
R7456:Axin1 UTSW 17 26143165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCCTGTTCAGGACTTTCC -3'
(R):5'- GTATCCAGACATGCCCTTCC -3'

Sequencing Primer
(F):5'- CTGCAGTGGCTTCAGGAAG -3'
(R):5'- CCTGTTCCAGACCCTGAGC -3'
Posted On2017-08-16