Mutagenetix > Incidental Mutation

Incidental Mutation 'R6108:Sptbn2'

485632

Institutional Source

Beutler Lab

Gene Symbol

Sptbn2

Ensembl Gene

ENSMUSG00000067889

Gene Name

spectrin beta, non-erythrocytic 2

Synonyms

Spnb3

MMRRC Submission

044258-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6108 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4761195-4802388 bp(+) (GRCm39)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to A at 4781420 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000008991 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000008991]

AlphaFold

Q68FG2

Predicted Effect

probably null
Transcript: ENSMUST00000008991

SMART Domains

Protein: ENSMUSP00000008991
Gene: ENSMUSG00000067889

Domain	Start	End	E-Value	Type
CH	59	159	1.86e-28	SMART
CH	178	276	2.86e-20	SMART
SPEC	308	414	4.63e-1	SMART
SPEC	428	528	3.07e-23	SMART
SPEC	534	638	4.47e-25	SMART
SPEC	644	744	1.28e-25	SMART
SPEC	750	849	4.98e-23	SMART
SPEC	855	955	1.63e-18	SMART
SPEC	961	1062	1.45e-24	SMART
SPEC	1068	1169	4.15e-20	SMART
SPEC	1175	1275	5.26e-22	SMART
SPEC	1281	1380	1.17e-19	SMART
SPEC	1386	1485	2.06e-24	SMART
SPEC	1491	1585	1.74e-22	SMART
SPEC	1591	1691	5.42e-24	SMART
SPEC	1697	1798	2.1e-21	SMART
SPEC	1804	1904	5.47e-20	SMART
SPEC	1910	2010	1.99e-22	SMART
SPEC	2016	2256	2.92e-6	SMART
PH	2219	2330	1.65e-14	SMART
low complexity region	2373	2386	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.8%

Validation Efficiency

96% (53/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are principle components of a cell's membrane-cytoskeleton and are composed of two alpha and two beta spectrin subunits. The protein encoded by this gene (SPTBN2), is called spectrin beta non-erythrocytic 2 or beta-III spectrin. It is related to, but distinct from, the beta-II spectrin gene which is also known as spectrin beta non-erythrocytic 1 (SPTBN1). SPTBN2 regulates the glutamate signaling pathway by stabilizing the glutamate transporter EAAT4 at the surface of the plasma membrane. Mutations in this gene cause a form of spinocerebellar ataxia, SCA5, that is characterized by neurodegeneration, progressive locomotor incoordination, dysarthria, and uncoordinated eye movements. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous hypomorphic mutants exhibit a progressive ataxic phenotype with gait abnormalities, tremor, deteriorating motor coordination, Purkinje cell loss, and cerebellar atrophy (molecular layer thinning) and age-related reduction in simple firing ratein surviving Purkinje cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	A	G	13: 81,539,814 (GRCm39)	F5702L	probably damaging	Het
Aptx	G	A	4: 40,694,986 (GRCm39)	Q117*	probably null	Het
Axin1	T	A	17: 26,362,214 (GRCm39)	M186K	probably damaging	Het
Btbd2	A	T	10: 80,481,365 (GRCm39)	L249Q	probably damaging	Het
Caprin1	C	T	2: 103,606,362 (GRCm39)	V293I	possibly damaging	Het
Ccdc136	C	A	6: 29,412,449 (GRCm39)	H334Q	probably benign	Het
Ccdc180	A	G	4: 45,911,389 (GRCm39)	N568S	possibly damaging	Het
Cenpf	A	T	1: 189,394,210 (GRCm39)	F515L	probably benign	Het
Chrm2	T	A	6: 36,500,230 (GRCm39)	V29E	probably damaging	Het
Cnot1	A	G	8: 96,457,048 (GRCm39)	L1956P	probably damaging	Het
Cyp2d22	T	C	15: 82,256,106 (GRCm39)	K176R	possibly damaging	Het
Dnah7a	A	T	1: 53,496,004 (GRCm39)	I3151N	probably damaging	Het
Dsg1a	T	A	18: 20,473,304 (GRCm39)	D792E	probably benign	Het
Fam167b	A	T	4: 129,472,101 (GRCm39)	L23*	probably null	Het
Fermt3	C	A	19: 6,991,782 (GRCm39)	R143L	probably benign	Het
Gfm2	A	G	13: 97,285,930 (GRCm39)	I140V	possibly damaging	Het
Gna14	A	G	19: 16,580,707 (GRCm39)	T182A	probably damaging	Het
Hmcn1	A	G	1: 150,506,978 (GRCm39)	V3738A	possibly damaging	Het
Hspa4	C	T	11: 53,152,539 (GRCm39)	G810D	probably damaging	Het
Igf2bp3	A	G	6: 49,094,308 (GRCm39)	I154T	probably damaging	Het
Il1rap	G	A	16: 26,541,457 (GRCm39)	S566N	probably damaging	Het
Kcnb1	G	A	2: 166,947,060 (GRCm39)	T596M	probably damaging	Het
Kcnn1	A	C	8: 71,307,800 (GRCm39)	S81A	probably benign	Het
Lmod1	G	A	1: 135,291,849 (GRCm39)	G235R	probably benign	Het
Mei1	A	T	15: 81,959,389 (GRCm39)	R185S	possibly damaging	Het
Mmrn1	G	A	6: 60,952,960 (GRCm39)	V414M	possibly damaging	Het
Mon2	C	A	10: 122,868,600 (GRCm39)	M484I	probably benign	Het
Nae1	A	T	8: 105,254,034 (GRCm39)	D99E	probably benign	Het
Nsun7	T	A	5: 66,453,142 (GRCm39)	I619N	probably damaging	Het
Nudt12	C	A	17: 59,314,744 (GRCm39)	R280L	probably damaging	Het
Or1l4	T	C	2: 37,091,778 (GRCm39)	V175A	possibly damaging	Het
P2ry1	T	A	3: 60,911,596 (GRCm39)	I245N	probably damaging	Het
Plch1	C	T	3: 63,609,444 (GRCm39)	R912H	probably damaging	Het
Plek	T	A	11: 16,940,058 (GRCm39)	Y217F	probably damaging	Het
Plpp1	A	T	13: 113,003,399 (GRCm39)	I208F	possibly damaging	Het
Ptges3-ps	C	T	6: 85,821,537 (GRCm39)		noncoding transcript	Het
Ptprf	A	G	4: 118,080,453 (GRCm39)	L1267P	probably benign	Het
Ptprz1	A	T	6: 23,045,658 (GRCm39)	S2143C	probably damaging	Het
Scn9a	T	C	2: 66,314,393 (GRCm39)	D1764G	probably damaging	Het
Serpinb5	T	A	1: 106,809,458 (GRCm39)	L288Q	probably damaging	Het
Slc6a20b	T	G	9: 123,425,251 (GRCm39)	M539L	probably benign	Het
Slfnl1	A	G	4: 120,390,558 (GRCm39)	T70A	probably benign	Het
Smtn	C	A	11: 3,479,608 (GRCm39)	L486F	probably damaging	Het
Tas2r144	C	A	6: 42,192,691 (GRCm39)	L144I	possibly damaging	Het
Tjp3	C	T	10: 81,116,980 (GRCm39)	R183K	probably benign	Het
Tnip3	A	G	6: 65,502,395 (GRCm39)		probably null	Het
Tspan12	T	A	6: 21,772,770 (GRCm39)	M212L	probably benign	Het
Ttn	T	A	2: 76,708,385 (GRCm39)		probably benign	Het
Vmn1r71	T	C	7: 10,482,545 (GRCm39)	M48V	probably benign	Het
Vmn2r10	A	G	5: 109,143,667 (GRCm39)	F761S	probably damaging	Het
Vmn2r106	G	A	17: 20,488,638 (GRCm39)	P587L	probably benign	Het
Wdr72	A	G	9: 74,058,950 (GRCm39)	T348A	probably damaging	Het
Xrn1	A	T	9: 95,856,480 (GRCm39)	L333F	possibly damaging	Het

Other mutations in Sptbn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Sptbn2	APN	19	4,774,733 (GRCm39)	missense	possibly damaging	0.94
IGL00688:Sptbn2	APN	19	4,775,966 (GRCm39)	missense	probably damaging	1.00
IGL01339:Sptbn2	APN	19	4,796,000 (GRCm39)	nonsense	probably null
IGL01373:Sptbn2	APN	19	4,796,000 (GRCm39)	nonsense	probably null
IGL01420:Sptbn2	APN	19	4,784,153 (GRCm39)	missense	probably benign
IGL01456:Sptbn2	APN	19	4,796,777 (GRCm39)	missense	probably damaging	1.00
IGL01953:Sptbn2	APN	19	4,799,721 (GRCm39)	missense	probably benign
IGL03026:Sptbn2	APN	19	4,774,261 (GRCm39)	critical splice donor site	probably null
IGL03275:Sptbn2	APN	19	4,782,689 (GRCm39)	missense	possibly damaging	0.65
IGL03286:Sptbn2	APN	19	4,797,860 (GRCm39)	missense	probably damaging	0.97
F5770:Sptbn2	UTSW	19	4,800,660 (GRCm39)	missense	probably damaging	1.00
PIT4696001:Sptbn2	UTSW	19	4,795,605 (GRCm39)	missense	probably benign	0.00
R0046:Sptbn2	UTSW	19	4,795,405 (GRCm39)	intron	probably benign
R0046:Sptbn2	UTSW	19	4,795,405 (GRCm39)	intron	probably benign
R0121:Sptbn2	UTSW	19	4,795,321 (GRCm39)	missense	probably damaging	1.00
R0127:Sptbn2	UTSW	19	4,774,772 (GRCm39)	missense	probably damaging	1.00
R0212:Sptbn2	UTSW	19	4,796,970 (GRCm39)	critical splice donor site	probably null
R0277:Sptbn2	UTSW	19	4,795,173 (GRCm39)	missense	probably benign	0.28
R0417:Sptbn2	UTSW	19	4,787,954 (GRCm39)	missense	probably benign	0.01
R0457:Sptbn2	UTSW	19	4,795,966 (GRCm39)	missense	possibly damaging	0.89
R0536:Sptbn2	UTSW	19	4,776,718 (GRCm39)	missense	probably damaging	0.99
R0631:Sptbn2	UTSW	19	4,790,014 (GRCm39)	missense	probably benign	0.01
R0734:Sptbn2	UTSW	19	4,798,151 (GRCm39)	nonsense	probably null
R0742:Sptbn2	UTSW	19	4,769,011 (GRCm39)	missense	possibly damaging	0.46
R1195:Sptbn2	UTSW	19	4,795,921 (GRCm39)	missense	possibly damaging	0.85
R1195:Sptbn2	UTSW	19	4,795,921 (GRCm39)	missense	possibly damaging	0.85
R1195:Sptbn2	UTSW	19	4,795,921 (GRCm39)	missense	possibly damaging	0.85
R1364:Sptbn2	UTSW	19	4,782,693 (GRCm39)	missense	probably damaging	1.00
R1495:Sptbn2	UTSW	19	4,769,004 (GRCm39)	missense	possibly damaging	0.92
R1498:Sptbn2	UTSW	19	4,794,274 (GRCm39)	missense	possibly damaging	0.94
R1606:Sptbn2	UTSW	19	4,800,270 (GRCm39)	critical splice donor site	probably null
R1678:Sptbn2	UTSW	19	4,800,525 (GRCm39)	missense	probably damaging	1.00
R1746:Sptbn2	UTSW	19	4,795,992 (GRCm39)	nonsense	probably null
R1820:Sptbn2	UTSW	19	4,776,624 (GRCm39)	missense	probably damaging	0.98
R1830:Sptbn2	UTSW	19	4,782,569 (GRCm39)	missense	probably benign	0.09
R1863:Sptbn2	UTSW	19	4,782,713 (GRCm39)	missense	possibly damaging	0.54
R1967:Sptbn2	UTSW	19	4,795,327 (GRCm39)	missense	probably benign	0.00
R2085:Sptbn2	UTSW	19	4,788,587 (GRCm39)	missense	probably benign	0.09
R2301:Sptbn2	UTSW	19	4,784,166 (GRCm39)	missense	probably benign	0.00
R2310:Sptbn2	UTSW	19	4,768,963 (GRCm39)	missense	probably benign	0.19
R2888:Sptbn2	UTSW	19	4,798,664 (GRCm39)	missense	possibly damaging	0.52
R3788:Sptbn2	UTSW	19	4,795,950 (GRCm39)	missense	probably damaging	1.00
R4429:Sptbn2	UTSW	19	4,788,383 (GRCm39)	missense	probably damaging	1.00
R4536:Sptbn2	UTSW	19	4,782,630 (GRCm39)	missense	probably damaging	1.00
R4662:Sptbn2	UTSW	19	4,789,267 (GRCm39)	missense	probably damaging	1.00
R4672:Sptbn2	UTSW	19	4,782,524 (GRCm39)	missense	probably benign	0.25
R4731:Sptbn2	UTSW	19	4,792,508 (GRCm39)	missense	probably damaging	0.96
R4747:Sptbn2	UTSW	19	4,798,182 (GRCm39)	missense	probably benign	0.27
R4889:Sptbn2	UTSW	19	4,779,458 (GRCm39)	missense	possibly damaging	0.69
R4891:Sptbn2	UTSW	19	4,788,497 (GRCm39)	missense	probably damaging	1.00
R4965:Sptbn2	UTSW	19	4,779,337 (GRCm39)	missense	probably benign	0.13
R4968:Sptbn2	UTSW	19	4,779,230 (GRCm39)	splice site	probably null
R4981:Sptbn2	UTSW	19	4,801,686 (GRCm39)	missense	probably benign	0.22
R5159:Sptbn2	UTSW	19	4,787,885 (GRCm39)	missense	probably benign	0.12
R5202:Sptbn2	UTSW	19	4,774,212 (GRCm39)	missense	probably damaging	1.00
R5253:Sptbn2	UTSW	19	4,800,110 (GRCm39)	missense	probably benign	0.01
R5294:Sptbn2	UTSW	19	4,768,936 (GRCm39)	missense	possibly damaging	0.67
R5465:Sptbn2	UTSW	19	4,800,133 (GRCm39)	missense	probably benign	0.00
R5546:Sptbn2	UTSW	19	4,775,978 (GRCm39)	missense	probably damaging	1.00
R5593:Sptbn2	UTSW	19	4,798,975 (GRCm39)	missense	probably damaging	1.00
R5780:Sptbn2	UTSW	19	4,774,695 (GRCm39)	missense	probably damaging	1.00
R5835:Sptbn2	UTSW	19	4,788,247 (GRCm39)	missense	probably damaging	1.00
R6008:Sptbn2	UTSW	19	4,789,306 (GRCm39)	missense	possibly damaging	0.89
R6236:Sptbn2	UTSW	19	4,798,166 (GRCm39)	missense	probably benign	0.01
R6307:Sptbn2	UTSW	19	4,774,674 (GRCm39)	missense	probably damaging	1.00
R6383:Sptbn2	UTSW	19	4,782,524 (GRCm39)	missense	possibly damaging	0.89
R6397:Sptbn2	UTSW	19	4,792,446 (GRCm39)	missense	possibly damaging	0.91
R6453:Sptbn2	UTSW	19	4,794,208 (GRCm39)	missense	possibly damaging	0.67
R6561:Sptbn2	UTSW	19	4,797,954 (GRCm39)	missense	probably benign	0.39
R6564:Sptbn2	UTSW	19	4,782,052 (GRCm39)	missense	probably damaging	1.00
R6644:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R6703:Sptbn2	UTSW	19	4,799,843 (GRCm39)	missense	probably benign
R6703:Sptbn2	UTSW	19	4,799,842 (GRCm39)	missense	probably benign
R6753:Sptbn2	UTSW	19	4,797,813 (GRCm39)	missense	probably benign	0.01
R7007:Sptbn2	UTSW	19	4,794,173 (GRCm39)	missense	possibly damaging	0.82
R7131:Sptbn2	UTSW	19	4,799,488 (GRCm39)	missense	probably null
R7219:Sptbn2	UTSW	19	4,774,201 (GRCm39)	missense	probably damaging	1.00
R7285:Sptbn2	UTSW	19	4,787,471 (GRCm39)	missense	probably benign	0.00
R7308:Sptbn2	UTSW	19	4,801,602 (GRCm39)	missense	probably benign
R7469:Sptbn2	UTSW	19	4,795,146 (GRCm39)	missense	probably benign	0.00
R7502:Sptbn2	UTSW	19	4,798,110 (GRCm39)	missense	probably benign	0.02
R7623:Sptbn2	UTSW	19	4,776,196 (GRCm39)	missense	probably damaging	1.00
R7635:Sptbn2	UTSW	19	4,794,235 (GRCm39)	missense	probably damaging	1.00
R7733:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7738:Sptbn2	UTSW	19	4,774,153 (GRCm39)	missense	probably damaging	1.00
R7742:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7767:Sptbn2	UTSW	19	4,784,171 (GRCm39)	missense	possibly damaging	0.62
R7795:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7796:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7871:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7877:Sptbn2	UTSW	19	4,794,290 (GRCm39)	missense	possibly damaging	0.93
R7920:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7921:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7923:Sptbn2	UTSW	19	4,796,827 (GRCm39)	missense	probably benign	0.01
R8137:Sptbn2	UTSW	19	4,787,431 (GRCm39)	missense	possibly damaging	0.81
R8305:Sptbn2	UTSW	19	4,779,158 (GRCm39)	missense	possibly damaging	0.81
R8695:Sptbn2	UTSW	19	4,796,724 (GRCm39)	missense	possibly damaging	0.86
R8790:Sptbn2	UTSW	19	4,782,052 (GRCm39)	missense	probably damaging	1.00
R9125:Sptbn2	UTSW	19	4,784,241 (GRCm39)	missense	probably benign	0.04
R9483:Sptbn2	UTSW	19	4,789,974 (GRCm39)	missense	probably damaging	1.00
R9620:Sptbn2	UTSW	19	4,800,535 (GRCm39)	missense	probably damaging	0.99
R9631:Sptbn2	UTSW	19	4,788,218 (GRCm39)	missense	probably damaging	1.00
R9646:Sptbn2	UTSW	19	4,795,341 (GRCm39)	missense	probably damaging	1.00
R9694:Sptbn2	UTSW	19	4,800,535 (GRCm39)	missense	probably damaging	0.99
V7580:Sptbn2	UTSW	19	4,800,660 (GRCm39)	missense	probably damaging	1.00
Z1176:Sptbn2	UTSW	19	4,795,219 (GRCm39)	missense	probably benign	0.01
Z1176:Sptbn2	UTSW	19	4,788,233 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTGTGTCATAGAGCTGCGG -3'
(R):5'- GTAAAACAAAAGCCTGCGGTCC -3'

Sequencing Primer
(F):5'- GGCTTGGGTCCCTCGTG -3'
(R):5'- AAAAGCCTGCGGTCCGATTTATTTC -3'

Posted On

2017-08-16