Incidental Mutation 'R6119:Ppp1r16b'
ID485642
Institutional Source Beutler Lab
Gene Symbol Ppp1r16b
Ensembl Gene ENSMUSG00000037754
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 16B
SynonymsC130078N17Rik, Wdt4, ANKRD4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6119 (G1)
Quality Score169.009
Status Validated
Chromosome2
Chromosomal Location158665398-158766334 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 158751127 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 209 (I209V)
Ref Sequence ENSEMBL: ENSMUSP00000099405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045503] [ENSMUST00000052927] [ENSMUST00000103116] [ENSMUST00000145073]
Predicted Effect probably benign
Transcript: ENSMUST00000045503
AA Change: I209V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000039540
Gene: ENSMUSG00000037754
AA Change: I209V

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
low complexity region 46 55 N/A INTRINSIC
ANK 67 96 5.69e2 SMART
ANK 100 129 5.04e-6 SMART
ANK 133 162 1.76e-5 SMART
ANK 228 257 4.43e-2 SMART
ANK 261 290 1.38e-3 SMART
low complexity region 301 314 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 504 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052927
AA Change: I209V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000062615
Gene: ENSMUSG00000037754
AA Change: I209V

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
low complexity region 46 55 N/A INTRINSIC
ANK 67 96 5.69e2 SMART
ANK 100 129 5.04e-6 SMART
ANK 133 162 1.76e-5 SMART
ANK 228 257 4.43e-2 SMART
ANK 261 290 1.38e-3 SMART
low complexity region 301 314 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 504 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103116
AA Change: I209V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000099405
Gene: ENSMUSG00000037754
AA Change: I209V

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
low complexity region 46 55 N/A INTRINSIC
ANK 67 96 5.69e2 SMART
ANK 100 129 5.04e-6 SMART
ANK 133 162 1.76e-5 SMART
ANK 228 257 4.43e-2 SMART
ANK 261 290 1.38e-3 SMART
low complexity region 301 314 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 504 517 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129902
Predicted Effect probably benign
Transcript: ENSMUST00000145073
AA Change: I151V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117310
Gene: ENSMUSG00000037754
AA Change: I151V

DomainStartEndE-ValueType
ANK 9 38 5.69e2 SMART
ANK 42 71 5.04e-6 SMART
ANK 75 104 1.76e-5 SMART
Blast:ANK 149 190 5e-18 BLAST
low complexity region 201 214 N/A INTRINSIC
low complexity region 227 242 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is membrane-associated and contains five ankyrin repeats, a protein phosphatase-1-interacting domain, and a carboxy-terminal CAAX box domain. Synthesis of the encoded protein is inhibited by transforming growth factor beta-1. The protein may bind to the membrane through its CAAX box domain and may act as a signaling molecule through interaction with protein phosphatase-1. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal with no detectable defects in thymopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C T 7: 27,565,713 R97* probably null Het
4930544D05Rik G A 11: 70,616,491 A121T probably damaging Het
Abtb2 A T 2: 103,702,310 E484D probably benign Het
Ankk1 A T 9: 49,426,883 W37R possibly damaging Het
Arhgap11a C A 2: 113,834,350 M529I probably benign Het
Btd G A 14: 31,641,108 probably benign Het
Ddx47 T C 6: 135,023,355 I438T probably benign Het
Dnhd1 A G 7: 105,709,440 T3379A probably benign Het
Dusp3 A G 11: 101,980,669 probably benign Het
Dync1h1 A G 12: 110,628,006 K1289E possibly damaging Het
Egf A T 3: 129,736,772 I247N probably benign Het
Erich1 A G 8: 14,033,692 L126P probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fat3 T A 9: 16,376,568 H553L possibly damaging Het
Gdpgp1 T C 7: 80,238,992 L257P probably damaging Het
Gimap8 T C 6: 48,658,954 I551T possibly damaging Het
Gnptab C A 10: 88,431,395 D449E probably damaging Het
Grb10 T C 11: 11,933,551 D513G probably damaging Het
Grin1 T G 2: 25,305,158 D283A probably damaging Het
Gtf2i A T 5: 134,287,057 probably null Het
Ip6k3 A G 17: 27,148,625 V199A possibly damaging Het
Kif17 T A 4: 138,288,332 Y405* probably null Het
Lair1 T C 7: 4,028,896 M71V probably benign Het
Mamdc2 G A 19: 23,353,315 T376M probably damaging Het
Msra G A 14: 64,440,734 R38C probably damaging Het
Mthfd1 A T 12: 76,303,673 I462F probably damaging Het
Mum1 A G 10: 80,229,031 K32E probably benign Het
Nbr1 A G 11: 101,567,112 probably null Het
Neb A G 2: 52,220,931 M181T probably benign Het
Noxo1 A G 17: 24,696,571 probably benign Het
Olfr1124 A T 2: 87,435,389 K301* probably null Het
Olfr1195 A G 2: 88,683,591 I47T probably damaging Het
Olfr181 A T 16: 58,926,532 I13N possibly damaging Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Optn C A 2: 5,021,323 probably null Het
Pclo A G 5: 14,677,019 probably benign Het
Prss12 A G 3: 123,489,609 I517V possibly damaging Het
Ripor2 C T 13: 24,614,644 probably benign Het
Rmnd5b A G 11: 51,625,709 S274P probably benign Het
Sftpa1 T A 14: 41,132,552 I32N probably damaging Het
Slc2a12 T A 10: 22,665,347 I367N probably damaging Het
Sorcs1 T C 19: 50,288,094 D340G probably damaging Het
Synj1 T C 16: 90,938,989 K1359E probably benign Het
Tcf12 T A 9: 71,868,265 E421V probably damaging Het
Tecta A T 9: 42,373,075 F905I probably benign Het
Tmem106a T A 11: 101,583,750 C58* probably null Het
Tmem131l A T 3: 83,898,382 F1585I probably damaging Het
Tnks2 T C 19: 36,879,352 S208P possibly damaging Het
Trim50 A G 5: 135,353,420 N42S probably benign Het
Tsc22d2 T A 3: 58,460,253 probably benign Het
Ttll3 T A 6: 113,394,741 L23H probably damaging Het
Vmn1r10 A G 6: 57,114,233 Y270C probably benign Het
Ypel3 T C 7: 126,778,365 V74A possibly damaging Het
Zfp677 A G 17: 21,397,808 T376A possibly damaging Het
Other mutations in Ppp1r16b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Ppp1r16b APN 2 158756965 missense probably damaging 1.00
IGL01024:Ppp1r16b APN 2 158740816 splice site probably benign
IGL01080:Ppp1r16b APN 2 158757172 missense probably damaging 0.99
IGL02106:Ppp1r16b APN 2 158746531 missense possibly damaging 0.51
IGL03084:Ppp1r16b APN 2 158761493 nonsense probably null
R0037:Ppp1r16b UTSW 2 158757209 missense probably damaging 0.98
R0037:Ppp1r16b UTSW 2 158757209 missense probably damaging 0.98
R0190:Ppp1r16b UTSW 2 158696063 missense probably damaging 1.00
R0294:Ppp1r16b UTSW 2 158746603 missense probably damaging 1.00
R1735:Ppp1r16b UTSW 2 158761495 missense possibly damaging 0.94
R1746:Ppp1r16b UTSW 2 158746665 critical splice donor site probably null
R1847:Ppp1r16b UTSW 2 158761435 missense probably damaging 0.99
R2297:Ppp1r16b UTSW 2 158761366 missense possibly damaging 0.88
R2509:Ppp1r16b UTSW 2 158761463 missense possibly damaging 0.87
R2923:Ppp1r16b UTSW 2 158756957 missense probably damaging 1.00
R3907:Ppp1r16b UTSW 2 158761490 missense probably benign 0.00
R4344:Ppp1r16b UTSW 2 158749186 missense probably damaging 1.00
R4373:Ppp1r16b UTSW 2 158761765 missense probably damaging 1.00
R4423:Ppp1r16b UTSW 2 158757254 missense probably benign 0.00
R4424:Ppp1r16b UTSW 2 158757254 missense probably benign 0.00
R4425:Ppp1r16b UTSW 2 158757254 missense probably benign 0.00
R4623:Ppp1r16b UTSW 2 158761463 missense possibly damaging 0.87
R5436:Ppp1r16b UTSW 2 158757333 intron probably benign
R6029:Ppp1r16b UTSW 2 158755217 missense possibly damaging 0.74
R6816:Ppp1r16b UTSW 2 158761675 missense probably benign 0.00
R6941:Ppp1r16b UTSW 2 158696148 missense probably damaging 1.00
R7048:Ppp1r16b UTSW 2 158757254 missense probably benign 0.00
R7101:Ppp1r16b UTSW 2 158761763 missense probably damaging 1.00
R7255:Ppp1r16b UTSW 2 158761391 missense probably benign 0.41
X0064:Ppp1r16b UTSW 2 158751127 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATTTGTGCCCTGGGTGAC -3'
(R):5'- TATATTCCAGGAGCAGCAGGG -3'

Sequencing Primer
(F):5'- TGACTGGCAGACTCTGACGAG -3'
(R):5'- GCCCAAGGTCTCAAGTGTATAG -3'
Posted On2017-08-16