Incidental Mutation 'R6119:Kif17'
ID485647
Institutional Source Beutler Lab
Gene Symbol Kif17
Ensembl Gene ENSMUSG00000028758
Gene Namekinesin family member 17
SynonymsN-4 kinesin, 5930435E01Rik, Kif17b
MMRRC Submission
Accession Numbers

Genbank: NM_010623; MGI: 1098229

Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R6119 (G1)
Quality Score181.009
Status Validated
Chromosome4
Chromosomal Location138250435-138301967 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 138288332 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 405 (Y405*)
Ref Sequence ENSEMBL: ENSMUSP00000101444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030539] [ENSMUST00000105818] [ENSMUST00000105821]
Predicted Effect probably null
Transcript: ENSMUST00000030539
AA Change: Y597*
SMART Domains Protein: ENSMUSP00000030539
Gene: ENSMUSG00000028758
AA Change: Y597*

DomainStartEndE-ValueType
KISc 3 343 4.57e-178 SMART
coiled coil region 400 470 N/A INTRINSIC
low complexity region 723 736 N/A INTRINSIC
coiled coil region 806 852 N/A INTRINSIC
low complexity region 983 1000 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105818
AA Change: Y405*
SMART Domains Protein: ENSMUSP00000101444
Gene: ENSMUSG00000028758
AA Change: Y405*

DomainStartEndE-ValueType
KISc 1 151 1.46e-13 SMART
coiled coil region 208 278 N/A INTRINSIC
low complexity region 532 545 N/A INTRINSIC
coiled coil region 615 661 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105820
Predicted Effect probably benign
Transcript: ENSMUST00000105821
SMART Domains Protein: ENSMUSP00000101447
Gene: ENSMUSG00000028758

DomainStartEndE-ValueType
KISc 3 343 4.57e-178 SMART
low complexity region 486 499 N/A INTRINSIC
coiled coil region 569 615 N/A INTRINSIC
Meta Mutation Damage Score 0.6348 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired anterograde neuron transport, reduced NMDA-mediated synaptic currents, impaired synaptic plasticity, impaired long term object recognition memory, impaired spatial learning, and impaired contextual conditioning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C T 7: 27,565,713 R97* probably null Het
4930544D05Rik G A 11: 70,616,491 A121T probably damaging Het
Abtb2 A T 2: 103,702,310 E484D probably benign Het
Ankk1 A T 9: 49,426,883 W37R possibly damaging Het
Arhgap11a C A 2: 113,834,350 M529I probably benign Het
Btd G A 14: 31,641,108 probably benign Het
Ddx47 T C 6: 135,023,355 I438T probably benign Het
Dnhd1 A G 7: 105,709,440 T3379A probably benign Het
Dusp3 A G 11: 101,980,669 probably benign Het
Dync1h1 A G 12: 110,628,006 K1289E possibly damaging Het
Egf A T 3: 129,736,772 I247N probably benign Het
Erich1 A G 8: 14,033,692 L126P probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fat3 T A 9: 16,376,568 H553L possibly damaging Het
Gdpgp1 T C 7: 80,238,992 L257P probably damaging Het
Gimap8 T C 6: 48,658,954 I551T possibly damaging Het
Gnptab C A 10: 88,431,395 D449E probably damaging Het
Grb10 T C 11: 11,933,551 D513G probably damaging Het
Grin1 T G 2: 25,305,158 D283A probably damaging Het
Gtf2i A T 5: 134,287,057 probably null Het
Ip6k3 A G 17: 27,148,625 V199A possibly damaging Het
Lair1 T C 7: 4,028,896 M71V probably benign Het
Mamdc2 G A 19: 23,353,315 T376M probably damaging Het
Msra G A 14: 64,440,734 R38C probably damaging Het
Mthfd1 A T 12: 76,303,673 I462F probably damaging Het
Mum1 A G 10: 80,229,031 K32E probably benign Het
Nbr1 A G 11: 101,567,112 probably null Het
Neb A G 2: 52,220,931 M181T probably benign Het
Noxo1 A G 17: 24,696,571 probably benign Het
Olfr1124 A T 2: 87,435,389 K301* probably null Het
Olfr1195 A G 2: 88,683,591 I47T probably damaging Het
Olfr181 A T 16: 58,926,532 I13N possibly damaging Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Optn C A 2: 5,021,323 probably null Het
Pclo A G 5: 14,677,019 probably benign Het
Ppp1r16b A G 2: 158,751,127 I209V probably benign Het
Prss12 A G 3: 123,489,609 I517V possibly damaging Het
Ripor2 C T 13: 24,614,644 probably benign Het
Rmnd5b A G 11: 51,625,709 S274P probably benign Het
Sftpa1 T A 14: 41,132,552 I32N probably damaging Het
Slc2a12 T A 10: 22,665,347 I367N probably damaging Het
Sorcs1 T C 19: 50,288,094 D340G probably damaging Het
Synj1 T C 16: 90,938,989 K1359E probably benign Het
Tcf12 T A 9: 71,868,265 E421V probably damaging Het
Tecta A T 9: 42,373,075 F905I probably benign Het
Tmem106a T A 11: 101,583,750 C58* probably null Het
Tmem131l A T 3: 83,898,382 F1585I probably damaging Het
Tnks2 T C 19: 36,879,352 S208P possibly damaging Het
Trim50 A G 5: 135,353,420 N42S probably benign Het
Tsc22d2 T A 3: 58,460,253 probably benign Het
Ttll3 T A 6: 113,394,741 L23H probably damaging Het
Vmn1r10 A G 6: 57,114,233 Y270C probably benign Het
Ypel3 T C 7: 126,778,365 V74A possibly damaging Het
Zfp677 A G 17: 21,397,808 T376A possibly damaging Het
Other mutations in Kif17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Kif17 APN 4 138262708 missense possibly damaging 0.66
IGL00973:Kif17 APN 4 138275057 missense probably benign 0.06
IGL01527:Kif17 APN 4 138269086 missense probably benign 0.21
IGL01559:Kif17 APN 4 138293769 missense probably damaging 0.99
IGL01736:Kif17 APN 4 138286565 missense possibly damaging 0.96
IGL02671:Kif17 APN 4 138288061 missense possibly damaging 0.85
IGL02976:Kif17 APN 4 138269063 missense probably damaging 1.00
IGL03051:Kif17 APN 4 138289254 missense probably damaging 0.99
IGL03285:Kif17 APN 4 138268990 missense probably damaging 0.97
easy_company UTSW 4 138288332 nonsense probably null
fiddle UTSW 4 138286480 missense probably benign 0.18
fidget UTSW 4 138269891 missense probably damaging 1.00
A5278:Kif17 UTSW 4 138287950 missense probably benign 0.33
R0012:Kif17 UTSW 4 138293748 missense probably damaging 0.99
R0012:Kif17 UTSW 4 138293748 missense probably damaging 0.99
R0133:Kif17 UTSW 4 138278245 missense possibly damaging 0.73
R0627:Kif17 UTSW 4 138288487 critical splice donor site probably null
R0670:Kif17 UTSW 4 138262499 unclassified probably benign
R0894:Kif17 UTSW 4 138298231 missense possibly damaging 0.93
R1367:Kif17 UTSW 4 138277994 nonsense probably null
R1648:Kif17 UTSW 4 138269895 missense probably damaging 1.00
R1674:Kif17 UTSW 4 138301258 missense probably benign 0.13
R1700:Kif17 UTSW 4 138262698 nonsense probably null
R1855:Kif17 UTSW 4 138288271 missense probably benign 0.44
R2137:Kif17 UTSW 4 138262667 missense probably damaging 0.98
R2170:Kif17 UTSW 4 138288371 missense probably benign 0.01
R3008:Kif17 UTSW 4 138278165 missense probably damaging 1.00
R3855:Kif17 UTSW 4 138291510 missense probably benign 0.18
R4591:Kif17 UTSW 4 138277799 missense probably benign 0.06
R4789:Kif17 UTSW 4 138281377 missense probably damaging 1.00
R5407:Kif17 UTSW 4 138298221 missense probably damaging 1.00
R5859:Kif17 UTSW 4 138291433 missense possibly damaging 0.71
R5901:Kif17 UTSW 4 138298332 splice site probably null
R5919:Kif17 UTSW 4 138269891 missense probably damaging 1.00
R6312:Kif17 UTSW 4 138288193 missense probably benign 0.40
R6693:Kif17 UTSW 4 138286480 missense probably benign 0.18
R6774:Kif17 UTSW 4 138274995 missense probably damaging 1.00
R6838:Kif17 UTSW 4 138278399 intron probably null
R6863:Kif17 UTSW 4 138269884 nonsense probably null
R7205:Kif17 UTSW 4 138293766 missense probably benign 0.21
R7307:Kif17 UTSW 4 138262643 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCGCTTTCGAGGAACCACAC -3'
(R):5'- CCGTAGAACATTCGCTACCTGC -3'

Sequencing Primer
(F):5'- TTGAGTCCAATGAGTGTTCCAC -3'
(R):5'- AGAACATTCGCTACCTGCTTAGGG -3'
Posted On2017-08-16