Incidental Mutation 'R6119:Gtf2i'
ID485649
Institutional Source Beutler Lab
Gene Symbol Gtf2i
Ensembl Gene ENSMUSG00000060261
Gene Namegeneral transcription factor II I
SynonymsBAP-135, 6030441I21Rik, TFII-I
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6119 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location134237834-134314760 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 134287057 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059042] [ENSMUST00000082057] [ENSMUST00000111261] [ENSMUST00000172715] [ENSMUST00000173263] [ENSMUST00000173341] [ENSMUST00000173504] [ENSMUST00000173651] [ENSMUST00000173888] [ENSMUST00000174155] [ENSMUST00000174188] [ENSMUST00000174354] [ENSMUST00000174513] [ENSMUST00000174772] [ENSMUST00000174867]
Predicted Effect probably null
Transcript: ENSMUST00000059042
SMART Domains Protein: ENSMUSP00000049625
Gene: ENSMUSG00000060261

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.4e-34 PFAM
low complexity region 328 338 N/A INTRINSIC
Pfam:GTF2I 361 436 3.4e-33 PFAM
Pfam:GTF2I 466 541 5e-34 PFAM
Pfam:GTF2I 571 646 3.3e-33 PFAM
Pfam:GTF2I 733 808 3.9e-33 PFAM
Pfam:GTF2I 868 943 9.4e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000082057
SMART Domains Protein: ENSMUSP00000080714
Gene: ENSMUSG00000060261

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.3e-34 PFAM
low complexity region 307 317 N/A INTRINSIC
Pfam:GTF2I 340 415 3.3e-33 PFAM
Pfam:GTF2I 445 520 4.9e-34 PFAM
Pfam:GTF2I 550 625 3.2e-33 PFAM
Pfam:GTF2I 712 787 3.8e-33 PFAM
Pfam:GTF2I 847 922 9.1e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111261
SMART Domains Protein: ENSMUSP00000106892
Gene: ENSMUSG00000060261

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.3e-34 PFAM
low complexity region 309 319 N/A INTRINSIC
Pfam:GTF2I 342 417 3.3e-33 PFAM
Pfam:GTF2I 447 522 4.9e-34 PFAM
Pfam:GTF2I 552 627 3.2e-33 PFAM
Pfam:GTF2I 714 789 3.8e-33 PFAM
Pfam:GTF2I 849 924 9.1e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000172715
SMART Domains Protein: ENSMUSP00000134035
Gene: ENSMUSG00000060261

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 9.7e-35 PFAM
low complexity region 243 253 N/A INTRINSIC
Pfam:GTF2I 276 351 2.4e-33 PFAM
Pfam:GTF2I 381 456 3.6e-34 PFAM
Pfam:GTF2I 486 561 2.4e-33 PFAM
Pfam:GTF2I 648 723 2.8e-33 PFAM
Pfam:GTF2I 783 858 6.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173263
Predicted Effect probably null
Transcript: ENSMUST00000173341
SMART Domains Protein: ENSMUSP00000133444
Gene: ENSMUSG00000060261

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1e-34 PFAM
low complexity region 288 298 N/A INTRINSIC
Pfam:GTF2I 321 396 2.6e-33 PFAM
Pfam:GTF2I 426 501 3.8e-34 PFAM
Pfam:GTF2I 531 606 2.5e-33 PFAM
Pfam:GTF2I 693 768 3e-33 PFAM
Pfam:GTF2I 832 907 7.1e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000173504
SMART Domains Protein: ENSMUSP00000134042
Gene: ENSMUSG00000060261

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 150 8.7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173651
Predicted Effect probably null
Transcript: ENSMUST00000173888
SMART Domains Protein: ENSMUSP00000133969
Gene: ENSMUSG00000060261

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.3e-34 PFAM
low complexity region 245 258 N/A INTRINSIC
low complexity region 269 279 N/A INTRINSIC
Pfam:GTF2I 302 377 3.2e-33 PFAM
Pfam:GTF2I 407 482 4.6e-34 PFAM
Pfam:GTF2I 512 587 3.1e-33 PFAM
Pfam:GTF2I 674 749 3.6e-33 PFAM
Pfam:GTF2I 809 884 8.7e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174133
SMART Domains Protein: ENSMUSP00000134111
Gene: ENSMUSG00000060261

DomainStartEndE-ValueType
low complexity region 66 78 N/A INTRINSIC
Pfam:GTF2I 96 170 2.7e-32 PFAM
low complexity region 209 225 N/A INTRINSIC
low complexity region 246 256 N/A INTRINSIC
Pfam:GTF2I 279 353 5.1e-31 PFAM
Pfam:GTF2I 384 437 2.7e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174155
SMART Domains Protein: ENSMUSP00000133566
Gene: ENSMUSG00000060261

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 186 1.6e-34 PFAM
low complexity region 328 338 N/A INTRINSIC
Pfam:GTF2I 361 435 3e-33 PFAM
Pfam:GTF2I 466 540 9.1e-34 PFAM
Pfam:GTF2I 571 645 1.8e-32 PFAM
Pfam:GTF2I 733 807 2.2e-33 PFAM
Pfam:GTF2I 868 942 6e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174188
SMART Domains Protein: ENSMUSP00000134636
Gene: ENSMUSG00000060261

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 159 3.6e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174354
SMART Domains Protein: ENSMUSP00000134440
Gene: ENSMUSG00000060261

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.3e-34 PFAM
low complexity region 309 319 N/A INTRINSIC
Pfam:GTF2I 342 417 3.3e-33 PFAM
Pfam:GTF2I 447 522 4.9e-34 PFAM
Pfam:GTF2I 552 627 3.2e-33 PFAM
Pfam:GTF2I 714 789 3.8e-33 PFAM
Pfam:GTF2I 849 924 9.1e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174513
SMART Domains Protein: ENSMUSP00000133489
Gene: ENSMUSG00000060261

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.3e-34 PFAM
low complexity region 288 298 N/A INTRINSIC
Pfam:GTF2I 321 396 3.2e-33 PFAM
Pfam:GTF2I 426 501 4.8e-34 PFAM
Pfam:GTF2I 531 606 3.2e-33 PFAM
Pfam:GTF2I 693 768 3.7e-33 PFAM
Pfam:GTF2I 828 903 8.9e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174772
SMART Domains Protein: ENSMUSP00000133740
Gene: ENSMUSG00000060261

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.3e-34 PFAM
low complexity region 307 317 N/A INTRINSIC
Pfam:GTF2I 340 415 3.3e-33 PFAM
Pfam:GTF2I 445 520 4.9e-34 PFAM
Pfam:GTF2I 550 625 3.2e-33 PFAM
Pfam:GTF2I 712 787 3.8e-33 PFAM
Pfam:GTF2I 847 922 9.1e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174773
Predicted Effect probably null
Transcript: ENSMUST00000174867
SMART Domains Protein: ENSMUSP00000133435
Gene: ENSMUSG00000060261

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 169 3.4e-27 PFAM
Meta Mutation Damage Score 0.6472 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphoprotein containing six characteristic repeat motifs. The encoded protein binds to the initiator element (Inr) and E-box element in promoters and functions as a regulator of transcription. This locus, along with several other neighboring genes, is deleted in Williams-Beuren syndrome. There are many closely related genes and pseudogenes for this gene on chromosome 7. This gene also has pseudogenes on chromosomes 9, 13, and 21. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for null allele is embryonic lethal, and show brain hemorrhage and neural tube defects. Although most heterozygote are normal and fertile, at low frequency, growth retardation and small head are also reported. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C T 7: 27,565,713 R97* probably null Het
4930544D05Rik G A 11: 70,616,491 A121T probably damaging Het
Abtb2 A T 2: 103,702,310 E484D probably benign Het
Ankk1 A T 9: 49,426,883 W37R possibly damaging Het
Arhgap11a C A 2: 113,834,350 M529I probably benign Het
Btd G A 14: 31,641,108 probably benign Het
Ddx47 T C 6: 135,023,355 I438T probably benign Het
Dnhd1 A G 7: 105,709,440 T3379A probably benign Het
Dusp3 A G 11: 101,980,669 probably benign Het
Dync1h1 A G 12: 110,628,006 K1289E possibly damaging Het
Egf A T 3: 129,736,772 I247N probably benign Het
Erich1 A G 8: 14,033,692 L126P probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fat3 T A 9: 16,376,568 H553L possibly damaging Het
Gdpgp1 T C 7: 80,238,992 L257P probably damaging Het
Gimap8 T C 6: 48,658,954 I551T possibly damaging Het
Gnptab C A 10: 88,431,395 D449E probably damaging Het
Grb10 T C 11: 11,933,551 D513G probably damaging Het
Grin1 T G 2: 25,305,158 D283A probably damaging Het
Ip6k3 A G 17: 27,148,625 V199A possibly damaging Het
Kif17 T A 4: 138,288,332 Y405* probably null Het
Lair1 T C 7: 4,028,896 M71V probably benign Het
Mamdc2 G A 19: 23,353,315 T376M probably damaging Het
Msra G A 14: 64,440,734 R38C probably damaging Het
Mthfd1 A T 12: 76,303,673 I462F probably damaging Het
Mum1 A G 10: 80,229,031 K32E probably benign Het
Nbr1 A G 11: 101,567,112 probably null Het
Neb A G 2: 52,220,931 M181T probably benign Het
Noxo1 A G 17: 24,696,571 probably benign Het
Olfr1124 A T 2: 87,435,389 K301* probably null Het
Olfr1195 A G 2: 88,683,591 I47T probably damaging Het
Olfr181 A T 16: 58,926,532 I13N possibly damaging Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Optn C A 2: 5,021,323 probably null Het
Pclo A G 5: 14,677,019 probably benign Het
Ppp1r16b A G 2: 158,751,127 I209V probably benign Het
Prss12 A G 3: 123,489,609 I517V possibly damaging Het
Ripor2 C T 13: 24,614,644 probably benign Het
Rmnd5b A G 11: 51,625,709 S274P probably benign Het
Sftpa1 T A 14: 41,132,552 I32N probably damaging Het
Slc2a12 T A 10: 22,665,347 I367N probably damaging Het
Sorcs1 T C 19: 50,288,094 D340G probably damaging Het
Synj1 T C 16: 90,938,989 K1359E probably benign Het
Tcf12 T A 9: 71,868,265 E421V probably damaging Het
Tecta A T 9: 42,373,075 F905I probably benign Het
Tmem106a T A 11: 101,583,750 C58* probably null Het
Tmem131l A T 3: 83,898,382 F1585I probably damaging Het
Tnks2 T C 19: 36,879,352 S208P possibly damaging Het
Trim50 A G 5: 135,353,420 N42S probably benign Het
Tsc22d2 T A 3: 58,460,253 probably benign Het
Ttll3 T A 6: 113,394,741 L23H probably damaging Het
Vmn1r10 A G 6: 57,114,233 Y270C probably benign Het
Ypel3 T C 7: 126,778,365 V74A possibly damaging Het
Zfp677 A G 17: 21,397,808 T376A possibly damaging Het
Other mutations in Gtf2i
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Gtf2i APN 5 134242748 missense probably damaging 1.00
IGL01565:Gtf2i APN 5 134255913 missense probably damaging 0.97
IGL01743:Gtf2i APN 5 134286893 missense probably damaging 1.00
IGL01809:Gtf2i APN 5 134249950 missense probably damaging 1.00
IGL02553:Gtf2i APN 5 134245161 missense probably damaging 1.00
IGL02814:Gtf2i APN 5 134286704 missense probably damaging 1.00
IGL02869:Gtf2i APN 5 134279427 splice site probably benign
IGL03018:Gtf2i APN 5 134289335 missense possibly damaging 0.79
IGL03051:Gtf2i APN 5 134242914 nonsense probably null
P0041:Gtf2i UTSW 5 134244888 splice site probably benign
R0330:Gtf2i UTSW 5 134251886 missense probably damaging 0.98
R0515:Gtf2i UTSW 5 134242919 missense probably damaging 1.00
R0529:Gtf2i UTSW 5 134261869 nonsense probably null
R0594:Gtf2i UTSW 5 134242173 splice site probably benign
R0650:Gtf2i UTSW 5 134261837 splice site probably benign
R1055:Gtf2i UTSW 5 134263624 missense probably damaging 1.00
R1079:Gtf2i UTSW 5 134242894 splice site probably benign
R1916:Gtf2i UTSW 5 134246848 missense probably damaging 1.00
R2969:Gtf2i UTSW 5 134251892 missense probably damaging 0.98
R3013:Gtf2i UTSW 5 134295504 splice site probably benign
R4392:Gtf2i UTSW 5 134260629 missense probably damaging 0.96
R4421:Gtf2i UTSW 5 134255037 missense possibly damaging 0.86
R4635:Gtf2i UTSW 5 134245174 missense probably damaging 1.00
R4763:Gtf2i UTSW 5 134255964 missense probably damaging 1.00
R4770:Gtf2i UTSW 5 134243560 missense possibly damaging 0.53
R5063:Gtf2i UTSW 5 134260571 missense probably damaging 1.00
R5195:Gtf2i UTSW 5 134244832 nonsense probably null
R5829:Gtf2i UTSW 5 134263693 missense probably damaging 1.00
R6005:Gtf2i UTSW 5 134255958 nonsense probably null
R6576:Gtf2i UTSW 5 134263702 missense probably damaging 1.00
R6936:Gtf2i UTSW 5 134242785 missense probably damaging 1.00
R7070:Gtf2i UTSW 5 134282803 missense probably damaging 1.00
R7071:Gtf2i UTSW 5 134263621 missense probably damaging 1.00
R7142:Gtf2i UTSW 5 134244851 missense possibly damaging 0.95
X0022:Gtf2i UTSW 5 134263616 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGCCTTGTTCTCCAAAATCCA -3'
(R):5'- TGTCTTTGGAATTGCTCTCTACCTTA -3'

Sequencing Primer
(F):5'- ATCCACTTCAAGGTTGCGAG -3'
(R):5'- CCTCTGGAAAAGCAGTGCTCTTAG -3'
Posted On2017-08-16