Incidental Mutation 'R6119:Lair1'
ID485655
Institutional Source Beutler Lab
Gene Symbol Lair1
Ensembl Gene ENSMUSG00000055541
Gene Nameleukocyte-associated Ig-like receptor 1
SynonymsmLair-1, Lair-1, 5133400O11Rik, D7Bwg0421e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6119 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location4003402-4063204 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4028896 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 71 (M71V)
Ref Sequence ENSEMBL: ENSMUSP00000104241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068865] [ENSMUST00000086400] [ENSMUST00000086401] [ENSMUST00000108600] [ENSMUST00000131126] [ENSMUST00000136616] [ENSMUST00000149395] [ENSMUST00000205296]
Predicted Effect probably benign
Transcript: ENSMUST00000068865
SMART Domains Protein: ENSMUSP00000070712
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 33 55 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086400
AA Change: M71V

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000083588
Gene: ENSMUSG00000055541
AA Change: M71V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4ETY|D 22 134 5e-79 PDB
SCOP:d1nkr_2 24 118 2e-9 SMART
Blast:IG 38 119 9e-27 BLAST
transmembrane domain 143 165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086401
AA Change: M71V

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000083589
Gene: ENSMUSG00000055541
AA Change: M71V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4ETY|D 22 134 1e-78 PDB
SCOP:d1nkr_2 24 118 2e-9 SMART
Blast:IG 38 119 2e-26 BLAST
transmembrane domain 143 165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108600
AA Change: M71V

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104241
Gene: ENSMUSG00000055541
AA Change: M71V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4ETY|D 22 133 8e-79 PDB
SCOP:d1nkr_2 24 118 1e-9 SMART
Blast:IG 38 119 6e-27 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119711
SMART Domains Protein: ENSMUSP00000113871
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4ETY|D 22 133 4e-79 PDB
SCOP:d1nkr_2 24 118 7e-9 SMART
Blast:IG 38 119 2e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131126
SMART Domains Protein: ENSMUSP00000121738
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136616
SMART Domains Protein: ENSMUSP00000122037
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149395
SMART Domains Protein: ENSMUSP00000116800
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206445
Meta Mutation Damage Score 0.1284 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inhibitory receptor found on peripheral mononuclear cells, including natural killer cells, T cells, and B cells. Inhibitory receptors regulate the immune response to prevent lysis of cells recognized as self. The gene is a member of both the immunoglobulin superfamily and the leukocyte-associated inhibitory receptor family. The gene maps to a region of 19q13.4 called the leukocyte receptor cluster, which contains at least 29 genes encoding leukocyte-expressed receptors of the immunoglobulin superfamily. The encoded protein has been identified as an anchor for tyrosine phosphatase SHP-1, and may induce cell death in myeloid leukemias. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are healthy and of normal longevity but show increased numbers of splenic B, regulatory T, and dendritic cells, and eosinophilia at a young age. Aging homozygotes display a higher frequency of activated and effector/memory T cells and a decreased IgG1 level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C T 7: 27,565,713 R97* probably null Het
4930544D05Rik G A 11: 70,616,491 A121T probably damaging Het
Abtb2 A T 2: 103,702,310 E484D probably benign Het
Ankk1 A T 9: 49,426,883 W37R possibly damaging Het
Arhgap11a C A 2: 113,834,350 M529I probably benign Het
Btd G A 14: 31,641,108 probably benign Het
Ddx47 T C 6: 135,023,355 I438T probably benign Het
Dnhd1 A G 7: 105,709,440 T3379A probably benign Het
Dusp3 A G 11: 101,980,669 probably benign Het
Dync1h1 A G 12: 110,628,006 K1289E possibly damaging Het
Egf A T 3: 129,736,772 I247N probably benign Het
Erich1 A G 8: 14,033,692 L126P probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fat3 T A 9: 16,376,568 H553L possibly damaging Het
Gdpgp1 T C 7: 80,238,992 L257P probably damaging Het
Gimap8 T C 6: 48,658,954 I551T possibly damaging Het
Gnptab C A 10: 88,431,395 D449E probably damaging Het
Grb10 T C 11: 11,933,551 D513G probably damaging Het
Grin1 T G 2: 25,305,158 D283A probably damaging Het
Gtf2i A T 5: 134,287,057 probably null Het
Ip6k3 A G 17: 27,148,625 V199A possibly damaging Het
Kif17 T A 4: 138,288,332 Y405* probably null Het
Mamdc2 G A 19: 23,353,315 T376M probably damaging Het
Msra G A 14: 64,440,734 R38C probably damaging Het
Mthfd1 A T 12: 76,303,673 I462F probably damaging Het
Mum1 A G 10: 80,229,031 K32E probably benign Het
Nbr1 A G 11: 101,567,112 probably null Het
Neb A G 2: 52,220,931 M181T probably benign Het
Noxo1 A G 17: 24,696,571 probably benign Het
Olfr1124 A T 2: 87,435,389 K301* probably null Het
Olfr1195 A G 2: 88,683,591 I47T probably damaging Het
Olfr181 A T 16: 58,926,532 I13N possibly damaging Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Optn C A 2: 5,021,323 probably null Het
Pclo A G 5: 14,677,019 probably benign Het
Ppp1r16b A G 2: 158,751,127 I209V probably benign Het
Prss12 A G 3: 123,489,609 I517V possibly damaging Het
Ripor2 C T 13: 24,614,644 probably benign Het
Rmnd5b A G 11: 51,625,709 S274P probably benign Het
Sftpa1 T A 14: 41,132,552 I32N probably damaging Het
Slc2a12 T A 10: 22,665,347 I367N probably damaging Het
Sorcs1 T C 19: 50,288,094 D340G probably damaging Het
Synj1 T C 16: 90,938,989 K1359E probably benign Het
Tcf12 T A 9: 71,868,265 E421V probably damaging Het
Tecta A T 9: 42,373,075 F905I probably benign Het
Tmem106a T A 11: 101,583,750 C58* probably null Het
Tmem131l A T 3: 83,898,382 F1585I probably damaging Het
Tnks2 T C 19: 36,879,352 S208P possibly damaging Het
Trim50 A G 5: 135,353,420 N42S probably benign Het
Tsc22d2 T A 3: 58,460,253 probably benign Het
Ttll3 T A 6: 113,394,741 L23H probably damaging Het
Vmn1r10 A G 6: 57,114,233 Y270C probably benign Het
Ypel3 T C 7: 126,778,365 V74A possibly damaging Het
Zfp677 A G 17: 21,397,808 T376A possibly damaging Het
Other mutations in Lair1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Lair1 APN 7 4028731 missense probably benign 0.01
IGL01475:Lair1 APN 7 4009684 utr 3 prime probably benign
IGL02696:Lair1 APN 7 4010849 intron probably benign
IGL02749:Lair1 APN 7 4028901 missense possibly damaging 0.50
R0396:Lair1 UTSW 7 4010786 missense probably damaging 1.00
R0703:Lair1 UTSW 7 4010760 missense probably null 0.99
R1053:Lair1 UTSW 7 4028785 missense probably damaging 1.00
R1332:Lair1 UTSW 7 4010596 missense possibly damaging 0.77
R1717:Lair1 UTSW 7 4010789 missense probably damaging 1.00
R2022:Lair1 UTSW 7 4063064 splice site probably null
R2509:Lair1 UTSW 7 4010783 missense probably damaging 1.00
R3721:Lair1 UTSW 7 4010783 missense probably damaging 1.00
R4021:Lair1 UTSW 7 4055916 critical splice donor site probably null
R4784:Lair1 UTSW 7 4009732 missense probably benign 0.15
R4873:Lair1 UTSW 7 4029034 missense probably benign 0.05
R4875:Lair1 UTSW 7 4029034 missense probably benign 0.05
R4940:Lair1 UTSW 7 4028949 missense probably benign 0.00
R5125:Lair1 UTSW 7 4010489 missense possibly damaging 0.92
R5178:Lair1 UTSW 7 4010489 missense possibly damaging 0.92
R5888:Lair1 UTSW 7 4010845 missense probably damaging 0.96
R5965:Lair1 UTSW 7 4029024 missense possibly damaging 0.46
R6265:Lair1 UTSW 7 4055827 intron probably benign
R6305:Lair1 UTSW 7 4010728 critical splice donor site probably null
R6915:Lair1 UTSW 7 4055953 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GTTGTAAGAACAAACCTGAGGTTG -3'
(R):5'- TGTTATGGCACTGTCCTCACTG -3'

Sequencing Primer
(F):5'- GGTTGGACCTGGGGCAG -3'
(R):5'- CACTGTCCTCACTGTGTATATTAAG -3'
Posted On2017-08-16