Incidental Mutation 'R6119:2310022A10Rik'
ID485656
Institutional Source Beutler Lab
Gene Symbol 2310022A10Rik
Ensembl Gene ENSMUSG00000049643
Gene NameRIKEN cDNA 2310022A10 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R6119 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location27553233-27582099 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 27565713 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 97 (R97*)
Ref Sequence ENSEMBL: ENSMUSP00000139696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067386] [ENSMUST00000187032] [ENSMUST00000187960] [ENSMUST00000191126]
Predicted Effect probably null
Transcript: ENSMUST00000067386
AA Change: R123*
SMART Domains Protein: ENSMUSP00000066803
Gene: ENSMUSG00000049643
AA Change: R123*

DomainStartEndE-ValueType
Blast:SAM 34 100 5e-20 BLAST
SCOP:d1b4fa_ 54 100 7e-5 SMART
low complexity region 164 176 N/A INTRINSIC
low complexity region 268 277 N/A INTRINSIC
low complexity region 300 325 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186826
Predicted Effect probably null
Transcript: ENSMUST00000187032
AA Change: R117*
SMART Domains Protein: ENSMUSP00000139423
Gene: ENSMUSG00000049643
AA Change: R117*

DomainStartEndE-ValueType
Blast:SAM 28 92 4e-20 BLAST
SCOP:d1b4fa_ 48 94 6e-5 SMART
low complexity region 158 170 N/A INTRINSIC
low complexity region 262 271 N/A INTRINSIC
low complexity region 294 319 N/A INTRINSIC
low complexity region 378 386 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000187960
AA Change: R123*
SMART Domains Protein: ENSMUSP00000140651
Gene: ENSMUSG00000049643
AA Change: R123*

DomainStartEndE-ValueType
Blast:SAM 34 98 4e-20 BLAST
SCOP:d1b4fa_ 54 100 6e-5 SMART
low complexity region 164 176 N/A INTRINSIC
low complexity region 268 277 N/A INTRINSIC
low complexity region 300 325 N/A INTRINSIC
low complexity region 384 392 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000190656
AA Change: R19*
Predicted Effect probably null
Transcript: ENSMUST00000191126
AA Change: R97*
SMART Domains Protein: ENSMUSP00000139696
Gene: ENSMUSG00000049643
AA Change: R97*

DomainStartEndE-ValueType
Blast:SAM 8 74 1e-22 BLAST
SCOP:d1b4fa_ 28 74 4e-5 SMART
low complexity region 138 150 N/A INTRINSIC
Meta Mutation Damage Score 0.6232 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544D05Rik G A 11: 70,616,491 A121T probably damaging Het
Abtb2 A T 2: 103,702,310 E484D probably benign Het
Ankk1 A T 9: 49,426,883 W37R possibly damaging Het
Arhgap11a C A 2: 113,834,350 M529I probably benign Het
Btd G A 14: 31,641,108 probably benign Het
Ddx47 T C 6: 135,023,355 I438T probably benign Het
Dnhd1 A G 7: 105,709,440 T3379A probably benign Het
Dusp3 A G 11: 101,980,669 probably benign Het
Dync1h1 A G 12: 110,628,006 K1289E possibly damaging Het
Egf A T 3: 129,736,772 I247N probably benign Het
Erich1 A G 8: 14,033,692 L126P probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fat3 T A 9: 16,376,568 H553L possibly damaging Het
Gdpgp1 T C 7: 80,238,992 L257P probably damaging Het
Gimap8 T C 6: 48,658,954 I551T possibly damaging Het
Gnptab C A 10: 88,431,395 D449E probably damaging Het
Grb10 T C 11: 11,933,551 D513G probably damaging Het
Grin1 T G 2: 25,305,158 D283A probably damaging Het
Gtf2i A T 5: 134,287,057 probably null Het
Ip6k3 A G 17: 27,148,625 V199A possibly damaging Het
Kif17 T A 4: 138,288,332 Y405* probably null Het
Lair1 T C 7: 4,028,896 M71V probably benign Het
Mamdc2 G A 19: 23,353,315 T376M probably damaging Het
Msra G A 14: 64,440,734 R38C probably damaging Het
Mthfd1 A T 12: 76,303,673 I462F probably damaging Het
Mum1 A G 10: 80,229,031 K32E probably benign Het
Nbr1 A G 11: 101,567,112 probably null Het
Neb A G 2: 52,220,931 M181T probably benign Het
Noxo1 A G 17: 24,696,571 probably benign Het
Olfr1124 A T 2: 87,435,389 K301* probably null Het
Olfr1195 A G 2: 88,683,591 I47T probably damaging Het
Olfr181 A T 16: 58,926,532 I13N possibly damaging Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Optn C A 2: 5,021,323 probably null Het
Pclo A G 5: 14,677,019 probably benign Het
Ppp1r16b A G 2: 158,751,127 I209V probably benign Het
Prss12 A G 3: 123,489,609 I517V possibly damaging Het
Ripor2 C T 13: 24,614,644 probably benign Het
Rmnd5b A G 11: 51,625,709 S274P probably benign Het
Sftpa1 T A 14: 41,132,552 I32N probably damaging Het
Slc2a12 T A 10: 22,665,347 I367N probably damaging Het
Sorcs1 T C 19: 50,288,094 D340G probably damaging Het
Synj1 T C 16: 90,938,989 K1359E probably benign Het
Tcf12 T A 9: 71,868,265 E421V probably damaging Het
Tecta A T 9: 42,373,075 F905I probably benign Het
Tmem106a T A 11: 101,583,750 C58* probably null Het
Tmem131l A T 3: 83,898,382 F1585I probably damaging Het
Tnks2 T C 19: 36,879,352 S208P possibly damaging Het
Trim50 A G 5: 135,353,420 N42S probably benign Het
Tsc22d2 T A 3: 58,460,253 probably benign Het
Ttll3 T A 6: 113,394,741 L23H probably damaging Het
Vmn1r10 A G 6: 57,114,233 Y270C probably benign Het
Ypel3 T C 7: 126,778,365 V74A possibly damaging Het
Zfp677 A G 17: 21,397,808 T376A possibly damaging Het
Other mutations in 2310022A10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02292:2310022A10Rik APN 7 27564557 missense probably benign 0.05
IGL03261:2310022A10Rik APN 7 27580438 nonsense probably null
R0305:2310022A10Rik UTSW 7 27574636 missense probably damaging 1.00
R1080:2310022A10Rik UTSW 7 27565684 missense probably benign
R1696:2310022A10Rik UTSW 7 27560597 missense possibly damaging 0.94
R1773:2310022A10Rik UTSW 7 27580595 missense probably damaging 0.98
R4171:2310022A10Rik UTSW 7 27565684 missense probably benign
R4583:2310022A10Rik UTSW 7 27574592 missense unknown
R4781:2310022A10Rik UTSW 7 27571651 missense probably damaging 1.00
R4806:2310022A10Rik UTSW 7 27565645 critical splice acceptor site probably null
R4998:2310022A10Rik UTSW 7 27571663 missense probably damaging 1.00
R5000:2310022A10Rik UTSW 7 27556521 missense probably benign 0.04
R5007:2310022A10Rik UTSW 7 27578767 missense probably damaging 1.00
R5008:2310022A10Rik UTSW 7 27578767 missense probably damaging 1.00
R5364:2310022A10Rik UTSW 7 27578767 missense probably damaging 1.00
R6991:2310022A10Rik UTSW 7 27580446 missense probably damaging 1.00
R7014:2310022A10Rik UTSW 7 27578773 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGCAGAATAGTACTAAGTTGAGCC -3'
(R):5'- TCATGAGTGAGAAAGAGCTCTATG -3'

Sequencing Primer
(F):5'- CAGACGTTAAGTGCTTGCAGCTC -3'
(R):5'- TATGAGCAGCCACTCCTCACTAG -3'
Posted On2017-08-16