Incidental Mutation 'R6119:Slc2a12'
ID485665
Institutional Source Beutler Lab
Gene Symbol Slc2a12
Ensembl Gene ENSMUSG00000037490
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 12
SynonymsGlut12, GLUT-12
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6119 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location22645011-22704285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22665347 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 367 (I367N)
Ref Sequence ENSEMBL: ENSMUSP00000043962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042261]
Predicted Effect probably damaging
Transcript: ENSMUST00000042261
AA Change: I367N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000043962
Gene: ENSMUSG00000037490
AA Change: I367N

DomainStartEndE-ValueType
Pfam:MFS_1 42 390 5.3e-27 PFAM
Pfam:Sugar_tr 47 381 9.1e-76 PFAM
Pfam:Sugar_tr 451 569 4e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159174
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC2A12 belongs to a family of transporters that catalyze the uptake of sugars through facilitated diffusion (Rogers et al., 2002). This family of transporters show conservation of 12 transmembrane helices as well as functionally significant amino acid residues (Joost and Thorens, 2001 [PubMed 11780753]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C T 7: 27,565,713 R97* probably null Het
4930544D05Rik G A 11: 70,616,491 A121T probably damaging Het
Abtb2 A T 2: 103,702,310 E484D probably benign Het
Ankk1 A T 9: 49,426,883 W37R possibly damaging Het
Arhgap11a C A 2: 113,834,350 M529I probably benign Het
Btd G A 14: 31,641,108 probably benign Het
Ddx47 T C 6: 135,023,355 I438T probably benign Het
Dnhd1 A G 7: 105,709,440 T3379A probably benign Het
Dusp3 A G 11: 101,980,669 probably benign Het
Dync1h1 A G 12: 110,628,006 K1289E possibly damaging Het
Egf A T 3: 129,736,772 I247N probably benign Het
Erich1 A G 8: 14,033,692 L126P probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fat3 T A 9: 16,376,568 H553L possibly damaging Het
Gdpgp1 T C 7: 80,238,992 L257P probably damaging Het
Gimap8 T C 6: 48,658,954 I551T possibly damaging Het
Gnptab C A 10: 88,431,395 D449E probably damaging Het
Grb10 T C 11: 11,933,551 D513G probably damaging Het
Grin1 T G 2: 25,305,158 D283A probably damaging Het
Gtf2i A T 5: 134,287,057 probably null Het
Ip6k3 A G 17: 27,148,625 V199A possibly damaging Het
Kif17 T A 4: 138,288,332 Y405* probably null Het
Lair1 T C 7: 4,028,896 M71V probably benign Het
Mamdc2 G A 19: 23,353,315 T376M probably damaging Het
Msra G A 14: 64,440,734 R38C probably damaging Het
Mthfd1 A T 12: 76,303,673 I462F probably damaging Het
Mum1 A G 10: 80,229,031 K32E probably benign Het
Nbr1 A G 11: 101,567,112 probably null Het
Neb A G 2: 52,220,931 M181T probably benign Het
Noxo1 A G 17: 24,696,571 probably benign Het
Olfr1124 A T 2: 87,435,389 K301* probably null Het
Olfr1195 A G 2: 88,683,591 I47T probably damaging Het
Olfr181 A T 16: 58,926,532 I13N possibly damaging Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Optn C A 2: 5,021,323 probably null Het
Pclo A G 5: 14,677,019 probably benign Het
Ppp1r16b A G 2: 158,751,127 I209V probably benign Het
Prss12 A G 3: 123,489,609 I517V possibly damaging Het
Ripor2 C T 13: 24,614,644 probably benign Het
Rmnd5b A G 11: 51,625,709 S274P probably benign Het
Sftpa1 T A 14: 41,132,552 I32N probably damaging Het
Sorcs1 T C 19: 50,288,094 D340G probably damaging Het
Synj1 T C 16: 90,938,989 K1359E probably benign Het
Tcf12 T A 9: 71,868,265 E421V probably damaging Het
Tecta A T 9: 42,373,075 F905I probably benign Het
Tmem106a T A 11: 101,583,750 C58* probably null Het
Tmem131l A T 3: 83,898,382 F1585I probably damaging Het
Tnks2 T C 19: 36,879,352 S208P possibly damaging Het
Trim50 A G 5: 135,353,420 N42S probably benign Het
Tsc22d2 T A 3: 58,460,253 probably benign Het
Ttll3 T A 6: 113,394,741 L23H probably damaging Het
Vmn1r10 A G 6: 57,114,233 Y270C probably benign Het
Ypel3 T C 7: 126,778,365 V74A possibly damaging Het
Zfp677 A G 17: 21,397,808 T376A possibly damaging Het
Other mutations in Slc2a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Slc2a12 APN 10 22664684 missense probably damaging 0.97
IGL02472:Slc2a12 APN 10 22665155 missense probably damaging 1.00
IGL03387:Slc2a12 APN 10 22665235 missense probably damaging 1.00
IGL03412:Slc2a12 APN 10 22664969 missense probably damaging 1.00
R0537:Slc2a12 UTSW 10 22665068 missense probably damaging 1.00
R0539:Slc2a12 UTSW 10 22692230 missense probably benign 0.04
R0744:Slc2a12 UTSW 10 22702016 unclassified probably benign
R0833:Slc2a12 UTSW 10 22702016 unclassified probably benign
R1056:Slc2a12 UTSW 10 22665451 missense probably benign 0.05
R1926:Slc2a12 UTSW 10 22665242 missense probably damaging 1.00
R2188:Slc2a12 UTSW 10 22664837 missense probably benign 0.01
R2471:Slc2a12 UTSW 10 22664807 missense probably damaging 1.00
R4212:Slc2a12 UTSW 10 22702094 missense probably benign 0.02
R4213:Slc2a12 UTSW 10 22702094 missense probably benign 0.02
R4543:Slc2a12 UTSW 10 22664786 missense probably damaging 1.00
R5203:Slc2a12 UTSW 10 22645314 critical splice donor site probably null
R5203:Slc2a12 UTSW 10 22692218 missense probably benign
R5223:Slc2a12 UTSW 10 22702032 missense probably damaging 0.99
R5500:Slc2a12 UTSW 10 22665137 missense probably damaging 1.00
R6149:Slc2a12 UTSW 10 22664502 missense probably benign 0.05
R6281:Slc2a12 UTSW 10 22665320 missense probably damaging 1.00
R6330:Slc2a12 UTSW 10 22664995 missense probably benign 0.00
R6385:Slc2a12 UTSW 10 22694030 missense possibly damaging 0.69
R6623:Slc2a12 UTSW 10 22664900 missense probably damaging 1.00
R6895:Slc2a12 UTSW 10 22692185 missense probably damaging 1.00
R7080:Slc2a12 UTSW 10 22665317 missense probably benign 0.34
R7152:Slc2a12 UTSW 10 22665554 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGCATCAACTGTCTTGAAGTC -3'
(R):5'- GAAGGTCATCTCCCCTTTCG -3'

Sequencing Primer
(F):5'- CATCAACTGTCTTGAAGTCTGTTGGC -3'
(R):5'- TTCCCCATGGGCATAAACGAG -3'
Posted On2017-08-16