Incidental Mutation 'R6119:Gnptab'
ID485667
Institutional Source Beutler Lab
Gene Symbol Gnptab
Ensembl Gene ENSMUSG00000035311
Gene NameN-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
SynonymsEG432486
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock #R6119 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location88379132-88447329 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 88431395 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 449 (D449E)
Ref Sequence ENSEMBL: ENSMUSP00000020251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020251] [ENSMUST00000151273]
Predicted Effect probably damaging
Transcript: ENSMUST00000020251
AA Change: D449E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020251
Gene: ENSMUSG00000035311
AA Change: D449E

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Stealth_CR1 73 101 6.6e-14 PFAM
Pfam:Stealth_CR2 322 429 8.8e-49 PFAM
NL 431 469 3.82e-7 SMART
low complexity region 480 490 N/A INTRINSIC
NL 498 536 2.37e-2 SMART
DMAP_binding 699 813 6.14e-38 SMART
Pfam:Stealth_CR3 934 982 2.9e-21 PFAM
Pfam:Stealth_CR4 1117 1173 7.9e-28 PFAM
transmembrane domain 1192 1214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141343
Predicted Effect probably benign
Transcript: ENSMUST00000151273
SMART Domains Protein: ENSMUSP00000118025
Gene: ENSMUSG00000035311

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155306
Meta Mutation Damage Score 0.042 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two of three subunit types of the membrane-bound enzyme N-acetylglucosamine-1-phosphotransferase, a heterohexameric complex composed of two alpha, two beta, and two gamma subunits. The encoded protein is proteolytically cleaved at the Lys928-Asp929 bond to yield mature alpha and beta polypeptides while the gamma subunits are the product of a distinct gene (GeneID 84572). In the Golgi apparatus, the heterohexameric complex catalyzes the first step in the synthesis of mannose 6-phosphate recognition markers on certain oligosaccharides of newly synthesized lysosomal enzymes. These recognition markers are essential for appropriate trafficking of lysosomal enzymes. Mutations in this gene have been associated with both mucolipidosis II and mucolipidosis IIIA.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations cause stunted growth, high lysosomal enzyme levels, skeletal defects, retinal degeneration and secretory cell lesions. Homozygotes for an ENU allele show skeletal and facial defects, altered enzymatic activities, lysosomal storage, Purkinje cell loss, ataxia and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C T 7: 27,565,713 R97* probably null Het
4930544D05Rik G A 11: 70,616,491 A121T probably damaging Het
Abtb2 A T 2: 103,702,310 E484D probably benign Het
Ankk1 A T 9: 49,426,883 W37R possibly damaging Het
Arhgap11a C A 2: 113,834,350 M529I probably benign Het
Btd G A 14: 31,641,108 probably benign Het
Ddx47 T C 6: 135,023,355 I438T probably benign Het
Dnhd1 A G 7: 105,709,440 T3379A probably benign Het
Dusp3 A G 11: 101,980,669 probably benign Het
Dync1h1 A G 12: 110,628,006 K1289E possibly damaging Het
Egf A T 3: 129,736,772 I247N probably benign Het
Erich1 A G 8: 14,033,692 L126P probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fat3 T A 9: 16,376,568 H553L possibly damaging Het
Gdpgp1 T C 7: 80,238,992 L257P probably damaging Het
Gimap8 T C 6: 48,658,954 I551T possibly damaging Het
Grb10 T C 11: 11,933,551 D513G probably damaging Het
Grin1 T G 2: 25,305,158 D283A probably damaging Het
Gtf2i A T 5: 134,287,057 probably null Het
Ip6k3 A G 17: 27,148,625 V199A possibly damaging Het
Kif17 T A 4: 138,288,332 Y405* probably null Het
Lair1 T C 7: 4,028,896 M71V probably benign Het
Mamdc2 G A 19: 23,353,315 T376M probably damaging Het
Msra G A 14: 64,440,734 R38C probably damaging Het
Mthfd1 A T 12: 76,303,673 I462F probably damaging Het
Mum1 A G 10: 80,229,031 K32E probably benign Het
Nbr1 A G 11: 101,567,112 probably null Het
Neb A G 2: 52,220,931 M181T probably benign Het
Noxo1 A G 17: 24,696,571 probably benign Het
Olfr1124 A T 2: 87,435,389 K301* probably null Het
Olfr1195 A G 2: 88,683,591 I47T probably damaging Het
Olfr181 A T 16: 58,926,532 I13N possibly damaging Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Optn C A 2: 5,021,323 probably null Het
Pclo A G 5: 14,677,019 probably benign Het
Ppp1r16b A G 2: 158,751,127 I209V probably benign Het
Prss12 A G 3: 123,489,609 I517V possibly damaging Het
Ripor2 C T 13: 24,614,644 probably benign Het
Rmnd5b A G 11: 51,625,709 S274P probably benign Het
Sftpa1 T A 14: 41,132,552 I32N probably damaging Het
Slc2a12 T A 10: 22,665,347 I367N probably damaging Het
Sorcs1 T C 19: 50,288,094 D340G probably damaging Het
Synj1 T C 16: 90,938,989 K1359E probably benign Het
Tcf12 T A 9: 71,868,265 E421V probably damaging Het
Tecta A T 9: 42,373,075 F905I probably benign Het
Tmem106a T A 11: 101,583,750 C58* probably null Het
Tmem131l A T 3: 83,898,382 F1585I probably damaging Het
Tnks2 T C 19: 36,879,352 S208P possibly damaging Het
Trim50 A G 5: 135,353,420 N42S probably benign Het
Tsc22d2 T A 3: 58,460,253 probably benign Het
Ttll3 T A 6: 113,394,741 L23H probably damaging Het
Vmn1r10 A G 6: 57,114,233 Y270C probably benign Het
Ypel3 T C 7: 126,778,365 V74A possibly damaging Het
Zfp677 A G 17: 21,397,808 T376A possibly damaging Het
Other mutations in Gnptab
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Gnptab APN 10 88433065 missense probably damaging 0.99
IGL01346:Gnptab APN 10 88436179 missense possibly damaging 0.65
IGL01626:Gnptab APN 10 88437495 missense probably damaging 0.98
IGL01642:Gnptab APN 10 88436132 missense possibly damaging 0.89
IGL02121:Gnptab APN 10 88429461 missense possibly damaging 0.90
IGL03076:Gnptab APN 10 88440289 missense possibly damaging 0.91
IGL03130:Gnptab APN 10 88436371 missense possibly damaging 0.95
maze UTSW 10 88432573 missense probably damaging 1.00
R0103:Gnptab UTSW 10 88429519 missense probably damaging 1.00
R0103:Gnptab UTSW 10 88429519 missense probably damaging 1.00
R0114:Gnptab UTSW 10 88433400 missense possibly damaging 0.48
R0206:Gnptab UTSW 10 88439510 missense probably damaging 0.98
R0288:Gnptab UTSW 10 88433105 missense probably benign 0.00
R0329:Gnptab UTSW 10 88440309 missense probably damaging 1.00
R0330:Gnptab UTSW 10 88440309 missense probably damaging 1.00
R0369:Gnptab UTSW 10 88433594 missense possibly damaging 0.87
R0385:Gnptab UTSW 10 88436525 missense probably damaging 1.00
R0522:Gnptab UTSW 10 88431466 splice site probably benign
R0569:Gnptab UTSW 10 88428557 missense possibly damaging 0.89
R0671:Gnptab UTSW 10 88443304 splice site probably benign
R0834:Gnptab UTSW 10 88429952 missense probably damaging 1.00
R1375:Gnptab UTSW 10 88432573 missense probably damaging 1.00
R1443:Gnptab UTSW 10 88434081 missense probably damaging 1.00
R1464:Gnptab UTSW 10 88445754 splice site probably benign
R1471:Gnptab UTSW 10 88445763 missense probably benign
R1570:Gnptab UTSW 10 88419454 missense probably damaging 0.99
R1612:Gnptab UTSW 10 88428482 splice site probably null
R1614:Gnptab UTSW 10 88414589 missense probably benign
R1638:Gnptab UTSW 10 88436167 missense possibly damaging 0.94
R1739:Gnptab UTSW 10 88436095 missense probably benign 0.14
R1894:Gnptab UTSW 10 88419127 missense possibly damaging 0.69
R2092:Gnptab UTSW 10 88440305 nonsense probably null
R2118:Gnptab UTSW 10 88436398 missense probably benign 0.13
R2144:Gnptab UTSW 10 88428506 missense possibly damaging 0.89
R2174:Gnptab UTSW 10 88434044 missense probably damaging 1.00
R3847:Gnptab UTSW 10 88433577 nonsense probably null
R3943:Gnptab UTSW 10 88433894 missense probably benign
R4434:Gnptab UTSW 10 88412622 missense probably damaging 1.00
R4545:Gnptab UTSW 10 88414595 missense probably benign 0.00
R4776:Gnptab UTSW 10 88436528 missense probably damaging 1.00
R4786:Gnptab UTSW 10 88436182 missense probably damaging 1.00
R4880:Gnptab UTSW 10 88432551 nonsense probably null
R4889:Gnptab UTSW 10 88433913 missense probably benign 0.00
R4923:Gnptab UTSW 10 88429623 missense probably benign 0.17
R5694:Gnptab UTSW 10 88414486 missense probably benign 0.01
R5943:Gnptab UTSW 10 88433514 missense probably benign 0.00
R6027:Gnptab UTSW 10 88433225 missense probably damaging 0.98
R6074:Gnptab UTSW 10 88433078 missense probably damaging 1.00
R6182:Gnptab UTSW 10 88429480 missense possibly damaging 0.71
R6757:Gnptab UTSW 10 88437502 missense probably damaging 0.98
R6910:Gnptab UTSW 10 88431396 missense probably damaging 1.00
R6911:Gnptab UTSW 10 88431396 missense probably damaging 1.00
R7094:Gnptab UTSW 10 88379504 missense possibly damaging 0.66
R7101:Gnptab UTSW 10 88440312 missense probably benign 0.19
R7164:Gnptab UTSW 10 88434070 nonsense probably null
R7214:Gnptab UTSW 10 88379157 unclassified probably benign
R7316:Gnptab UTSW 10 88400710 missense probably damaging 1.00
X0064:Gnptab UTSW 10 88436530 missense probably damaging 1.00
X0066:Gnptab UTSW 10 88412011 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATATCAGCAGCCAGTCTGTG -3'
(R):5'- CCAGAGAAGTGCCTTCAACAATG -3'

Sequencing Primer
(F):5'- CTCTTCGATTTTGTCACAGG -3'
(R):5'- TGGATCCCATGAACCAGTTG -3'
Posted On2017-08-16