Incidental Mutation 'R6119:Dusp3'
ID485675
Institutional Source Beutler Lab
Gene Symbol Dusp3
Ensembl Gene ENSMUSG00000003518
Gene Namedual specificity phosphatase 3 (vaccinia virus phosphatase VH1-related)
SynonymsT-DSP11, 5031436O03Rik, 2210015O03Rik, VHR
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6119 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location101971143-101987013 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 101980669 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003612] [ENSMUST00000107172] [ENSMUST00000107173] [ENSMUST00000143177] [ENSMUST00000151678] [ENSMUST00000175972] [ENSMUST00000176261] [ENSMUST00000176722]
Predicted Effect probably benign
Transcript: ENSMUST00000003612
SMART Domains Protein: ENSMUSP00000003612
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 29 176 8.04e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107172
SMART Domains Protein: ENSMUSP00000102790
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 29 176 8.04e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107173
SMART Domains Protein: ENSMUSP00000102791
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 54 201 8.04e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125794
Predicted Effect probably benign
Transcript: ENSMUST00000143177
SMART Domains Protein: ENSMUSP00000135821
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
PDB:1J4X|A 2 55 1e-22 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000151678
SMART Domains Protein: ENSMUSP00000135384
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 3 108 6.99e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175972
Predicted Effect unknown
Transcript: ENSMUST00000176261
AA Change: S136P
SMART Domains Protein: ENSMUSP00000135443
Gene: ENSMUSG00000003518
AA Change: S136P

DomainStartEndE-ValueType
Pfam:DSPc 37 126 1.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176722
SMART Domains Protein: ENSMUSP00000134890
Gene: ENSMUSG00000010841

DomainStartEndE-ValueType
Pfam:KIAA1430 1 80 4.8e-22 PFAM
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene maps in a region that contains the BRCA1 locus which confers susceptibility to breast and ovarian cancer. Although DUSP3 is expressed in both breast and ovarian tissues, mutation screening in breast cancer pedigrees and in sporadic tumors was negative, leading to the conclusion that this gene is not BRCA1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased hemoglobin content and angiogenesis in Matrigel plugs and aortic explants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C T 7: 27,565,713 R97* probably null Het
4930544D05Rik G A 11: 70,616,491 A121T probably damaging Het
Abtb2 A T 2: 103,702,310 E484D probably benign Het
Ankk1 A T 9: 49,426,883 W37R possibly damaging Het
Arhgap11a C A 2: 113,834,350 M529I probably benign Het
Btd G A 14: 31,641,108 probably benign Het
Ddx47 T C 6: 135,023,355 I438T probably benign Het
Dnhd1 A G 7: 105,709,440 T3379A probably benign Het
Dync1h1 A G 12: 110,628,006 K1289E possibly damaging Het
Egf A T 3: 129,736,772 I247N probably benign Het
Erich1 A G 8: 14,033,692 L126P probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fat3 T A 9: 16,376,568 H553L possibly damaging Het
Gdpgp1 T C 7: 80,238,992 L257P probably damaging Het
Gimap8 T C 6: 48,658,954 I551T possibly damaging Het
Gnptab C A 10: 88,431,395 D449E probably damaging Het
Grb10 T C 11: 11,933,551 D513G probably damaging Het
Grin1 T G 2: 25,305,158 D283A probably damaging Het
Gtf2i A T 5: 134,287,057 probably null Het
Ip6k3 A G 17: 27,148,625 V199A possibly damaging Het
Kif17 T A 4: 138,288,332 Y405* probably null Het
Lair1 T C 7: 4,028,896 M71V probably benign Het
Mamdc2 G A 19: 23,353,315 T376M probably damaging Het
Msra G A 14: 64,440,734 R38C probably damaging Het
Mthfd1 A T 12: 76,303,673 I462F probably damaging Het
Mum1 A G 10: 80,229,031 K32E probably benign Het
Nbr1 A G 11: 101,567,112 probably null Het
Neb A G 2: 52,220,931 M181T probably benign Het
Noxo1 A G 17: 24,696,571 probably benign Het
Olfr1124 A T 2: 87,435,389 K301* probably null Het
Olfr1195 A G 2: 88,683,591 I47T probably damaging Het
Olfr181 A T 16: 58,926,532 I13N possibly damaging Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Optn C A 2: 5,021,323 probably null Het
Pclo A G 5: 14,677,019 probably benign Het
Ppp1r16b A G 2: 158,751,127 I209V probably benign Het
Prss12 A G 3: 123,489,609 I517V possibly damaging Het
Ripor2 C T 13: 24,614,644 probably benign Het
Rmnd5b A G 11: 51,625,709 S274P probably benign Het
Sftpa1 T A 14: 41,132,552 I32N probably damaging Het
Slc2a12 T A 10: 22,665,347 I367N probably damaging Het
Sorcs1 T C 19: 50,288,094 D340G probably damaging Het
Synj1 T C 16: 90,938,989 K1359E probably benign Het
Tcf12 T A 9: 71,868,265 E421V probably damaging Het
Tecta A T 9: 42,373,075 F905I probably benign Het
Tmem106a T A 11: 101,583,750 C58* probably null Het
Tmem131l A T 3: 83,898,382 F1585I probably damaging Het
Tnks2 T C 19: 36,879,352 S208P possibly damaging Het
Trim50 A G 5: 135,353,420 N42S probably benign Het
Tsc22d2 T A 3: 58,460,253 probably benign Het
Ttll3 T A 6: 113,394,741 L23H probably damaging Het
Vmn1r10 A G 6: 57,114,233 Y270C probably benign Het
Ypel3 T C 7: 126,778,365 V74A possibly damaging Het
Zfp677 A G 17: 21,397,808 T376A possibly damaging Het
Other mutations in Dusp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Dusp3 APN 11 101984644 missense probably benign 0.37
R0189:Dusp3 UTSW 11 101981721 missense probably damaging 1.00
R0751:Dusp3 UTSW 11 101981728 missense probably benign 0.00
R1771:Dusp3 UTSW 11 101984735 start codon destroyed probably null 0.95
R2220:Dusp3 UTSW 11 101974805 missense probably damaging 1.00
R2762:Dusp3 UTSW 11 101974835 missense probably benign 0.00
R4591:Dusp3 UTSW 11 101973620 utr 3 prime probably benign
R5373:Dusp3 UTSW 11 101984625 missense possibly damaging 0.69
R5374:Dusp3 UTSW 11 101984625 missense possibly damaging 0.69
R6318:Dusp3 UTSW 11 101986871 missense probably benign 0.32
R6495:Dusp3 UTSW 11 101981827 missense probably benign 0.00
X0020:Dusp3 UTSW 11 101974778 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GTTCAGAAATGCCCAGTCACTGAG -3'
(R):5'- GCTGAATGAGAGCTGGCTAGTG -3'

Sequencing Primer
(F):5'- TGCCCAGTCACTGAGCTAGTTAAG -3'
(R):5'- TGGCTAGTGGTCAGACAGGAC -3'
Posted On2017-08-16