Incidental Mutation 'R6119:Mthfd1'
ID485677
Institutional Source Beutler Lab
Gene Symbol Mthfd1
Ensembl Gene ENSMUSG00000021048
Gene Namemethylenetetrahydrofolate dehydrogenase (NADP+ dependent), methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthase
SynonymsMthfd, DCS, E430024A07Rik
MMRRC Submission
Accession Numbers

Genbank: NM_138745; MGI: 1342005

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6119 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location76255298-76319803 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76303673 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 462 (I462F)
Ref Sequence ENSEMBL: ENSMUSP00000151500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021443] [ENSMUST00000220046] [ENSMUST00000220321]
Predicted Effect probably damaging
Transcript: ENSMUST00000021443
AA Change: I642F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021443
Gene: ENSMUSG00000021048
AA Change: I642F

DomainStartEndE-ValueType
Pfam:THF_DHG_CYH 6 125 1.7e-36 PFAM
Pfam:THF_DHG_CYH_C 128 295 1.1e-67 PFAM
Pfam:FTHFS 317 935 4.1e-259 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218513
Predicted Effect probably damaging
Transcript: ENSMUST00000220046
AA Change: I462F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000220321
Meta Mutation Damage Score 0.41 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: This gene encodes a trifunctional cytoplasmic enzyme. The encoded protein functions as a methylenetetrahydrofolate dehydrogenase, a methenyltetrahydrofolate cyclohydrolase, and a formyltetrahydrofolate synthase. The encoded enzyme functions in de novo synthesis of purines and thymidylate and in regeneration of methionine from homocysteine. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality. Mice heterozygous for a gene trap allele exhibit altered amino acid levels and nucleotide metabolism related to dietary folate and choline concentrations. [provided by MGI curators]
Allele List at MGI

All alleles(57) : Targeted, other(2) Gene trapped(54) Radiation induced(1)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C T 7: 27,565,713 R97* probably null Het
4930544D05Rik G A 11: 70,616,491 A121T probably damaging Het
Abtb2 A T 2: 103,702,310 E484D probably benign Het
Ankk1 A T 9: 49,426,883 W37R possibly damaging Het
Arhgap11a C A 2: 113,834,350 M529I probably benign Het
Btd G A 14: 31,641,108 probably benign Het
Ddx47 T C 6: 135,023,355 I438T probably benign Het
Dnhd1 A G 7: 105,709,440 T3379A probably benign Het
Dusp3 A G 11: 101,980,669 probably benign Het
Dync1h1 A G 12: 110,628,006 K1289E possibly damaging Het
Egf A T 3: 129,736,772 I247N probably benign Het
Erich1 A G 8: 14,033,692 L126P probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fat3 T A 9: 16,376,568 H553L possibly damaging Het
Gdpgp1 T C 7: 80,238,992 L257P probably damaging Het
Gimap8 T C 6: 48,658,954 I551T possibly damaging Het
Gnptab C A 10: 88,431,395 D449E probably damaging Het
Grb10 T C 11: 11,933,551 D513G probably damaging Het
Grin1 T G 2: 25,305,158 D283A probably damaging Het
Gtf2i A T 5: 134,287,057 probably null Het
Ip6k3 A G 17: 27,148,625 V199A possibly damaging Het
Kif17 T A 4: 138,288,332 Y405* probably null Het
Lair1 T C 7: 4,028,896 M71V probably benign Het
Mamdc2 G A 19: 23,353,315 T376M probably damaging Het
Msra G A 14: 64,440,734 R38C probably damaging Het
Mum1 A G 10: 80,229,031 K32E probably benign Het
Nbr1 A G 11: 101,567,112 probably null Het
Neb A G 2: 52,220,931 M181T probably benign Het
Noxo1 A G 17: 24,696,571 probably benign Het
Olfr1124 A T 2: 87,435,389 K301* probably null Het
Olfr1195 A G 2: 88,683,591 I47T probably damaging Het
Olfr181 A T 16: 58,926,532 I13N possibly damaging Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Optn C A 2: 5,021,323 probably null Het
Pclo A G 5: 14,677,019 probably benign Het
Ppp1r16b A G 2: 158,751,127 I209V probably benign Het
Prss12 A G 3: 123,489,609 I517V possibly damaging Het
Ripor2 C T 13: 24,614,644 probably benign Het
Rmnd5b A G 11: 51,625,709 S274P probably benign Het
Sftpa1 T A 14: 41,132,552 I32N probably damaging Het
Slc2a12 T A 10: 22,665,347 I367N probably damaging Het
Sorcs1 T C 19: 50,288,094 D340G probably damaging Het
Synj1 T C 16: 90,938,989 K1359E probably benign Het
Tcf12 T A 9: 71,868,265 E421V probably damaging Het
Tecta A T 9: 42,373,075 F905I probably benign Het
Tmem106a T A 11: 101,583,750 C58* probably null Het
Tmem131l A T 3: 83,898,382 F1585I probably damaging Het
Tnks2 T C 19: 36,879,352 S208P possibly damaging Het
Trim50 A G 5: 135,353,420 N42S probably benign Het
Tsc22d2 T A 3: 58,460,253 probably benign Het
Ttll3 T A 6: 113,394,741 L23H probably damaging Het
Vmn1r10 A G 6: 57,114,233 Y270C probably benign Het
Ypel3 T C 7: 126,778,365 V74A possibly damaging Het
Zfp677 A G 17: 21,397,808 T376A possibly damaging Het
Other mutations in Mthfd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Mthfd1 APN 12 76300439 missense possibly damaging 0.79
IGL01996:Mthfd1 APN 12 76303905 missense probably damaging 1.00
IGL02399:Mthfd1 APN 12 76317632 missense probably damaging 1.00
IGL02529:Mthfd1 APN 12 76303709 missense probably benign 0.02
3-1:Mthfd1 UTSW 12 76314400 critical splice acceptor site probably null
R0062:Mthfd1 UTSW 12 76297589 splice site probably benign
R0062:Mthfd1 UTSW 12 76297589 splice site probably benign
R0732:Mthfd1 UTSW 12 76294174 missense probably damaging 1.00
R1572:Mthfd1 UTSW 12 76270419 nonsense probably null
R1918:Mthfd1 UTSW 12 76314976 missense probably damaging 1.00
R2008:Mthfd1 UTSW 12 76297519 missense probably damaging 1.00
R2280:Mthfd1 UTSW 12 76280492 missense probably benign 0.37
R2857:Mthfd1 UTSW 12 76288925 missense probably damaging 0.99
R2859:Mthfd1 UTSW 12 76288925 missense probably damaging 0.99
R2997:Mthfd1 UTSW 12 76315036 missense probably benign 0.01
R3034:Mthfd1 UTSW 12 76289470 missense probably benign 0.04
R3153:Mthfd1 UTSW 12 76311963 missense probably benign
R3412:Mthfd1 UTSW 12 76303749 splice site probably null
R4135:Mthfd1 UTSW 12 76282874 splice site probably null
R4245:Mthfd1 UTSW 12 76301273 missense probably damaging 0.99
R4498:Mthfd1 UTSW 12 76314990 missense probably damaging 1.00
R4573:Mthfd1 UTSW 12 76294138 critical splice acceptor site probably null
R5022:Mthfd1 UTSW 12 76294374 missense probably damaging 1.00
R5022:Mthfd1 UTSW 12 76301328 missense probably damaging 1.00
R5037:Mthfd1 UTSW 12 76294140 missense probably damaging 1.00
R5455:Mthfd1 UTSW 12 76301288 missense probably benign 0.20
R5879:Mthfd1 UTSW 12 76294218 missense probably benign 0.00
R5902:Mthfd1 UTSW 12 76291052 missense probably benign 0.01
R6199:Mthfd1 UTSW 12 76288911 missense probably damaging 1.00
R6199:Mthfd1 UTSW 12 76303680 missense probably damaging 1.00
R6931:Mthfd1 UTSW 12 76303698 missense probably benign
X0012:Mthfd1 UTSW 12 76314408 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- CCTTCTTACTGTAGCTGAGGTG -3'
(R):5'- AGCTTCCGTTACTGCAAGGG -3'

Sequencing Primer
(F):5'- TACTTGGCATGCTAAAGGCC -3'
(R):5'- TCCGTTACTGCAAGGGAGAGG -3'
Posted On2017-08-16