Incidental Mutation 'R6120:Vmn2r115'
ID485738
Institutional Source Beutler Lab
Gene Symbol Vmn2r115
Ensembl Gene ENSMUSG00000091076
Gene Namevomeronasal 2, receptor 115
SynonymsEG638102
MMRRC Submission 044268-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R6120 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location23343977-23360128 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23346029 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 297 (W297R)
Ref Sequence ENSEMBL: ENSMUSP00000131447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168175]
Predicted Effect probably damaging
Transcript: ENSMUST00000168175
AA Change: W297R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131447
Gene: ENSMUSG00000091076
AA Change: W297R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 471 1.4e-28 PFAM
Pfam:NCD3G 512 565 2.9e-20 PFAM
Pfam:7tm_3 598 833 5e-55 PFAM
Meta Mutation Damage Score 0.0692 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.6%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T A 18: 6,638,795 V398E possibly damaging Het
Ankef1 A G 2: 136,550,376 N495S probably benign Het
Bpifb3 G T 2: 153,931,443 V428L probably benign Het
Btd G A 14: 31,641,108 probably benign Het
Ccdc178 A G 18: 22,097,728 L362S probably benign Het
Ccdc33 G A 9: 58,086,600 P88S probably damaging Het
Cdk14 A T 5: 4,894,029 D385E probably damaging Het
Chrna4 A G 2: 181,024,806 L613P probably damaging Het
Cnot3 T A 7: 3,645,336 probably null Het
Csf1 T A 3: 107,753,854 I116L probably damaging Het
Csrp2 G T 10: 110,939,279 A192S probably benign Het
Dnah9 T C 11: 66,147,399 T104A probably benign Het
Eml1 C T 12: 108,527,724 P593S probably damaging Het
Entpd2 T A 2: 25,399,466 I320N probably benign Het
Exosc9 A T 3: 36,554,672 N140I probably damaging Het
Fam186a T C 15: 99,940,363 T2667A probably benign Het
Fes T C 7: 80,380,867 D558G probably damaging Het
Fgfr2 G T 7: 130,228,690 T186K probably benign Het
Fnip1 A G 11: 54,510,000 E1075G probably benign Het
Gbf1 A G 19: 46,279,321 I1203V possibly damaging Het
Gja1 T A 10: 56,388,505 M320K probably benign Het
Gm5431 A G 11: 48,894,781 Y256H probably benign Het
Gpr20 C T 15: 73,696,004 V179M probably damaging Het
Greb1 T G 12: 16,708,621 D698A probably damaging Het
Hook2 A G 8: 84,998,125 E500G probably damaging Het
Kif13b A T 14: 64,751,558 N796I probably damaging Het
Kif1a C T 1: 93,024,574 probably null Het
Lama1 T C 17: 67,780,617 probably null Het
Mfsd1 C T 3: 67,594,385 Q246* probably null Het
Mkrn3 A G 7: 62,419,534 S170P probably benign Het
Ms4a6b A G 19: 11,521,695 M58V probably benign Het
Muc4 T C 16: 32,756,795 V2223A unknown Het
Mycbp2 A T 14: 103,275,887 V811D probably benign Het
Olfr1015 T C 2: 85,786,341 F277L probably damaging Het
Olfr483 A T 7: 108,104,133 N275Y probably damaging Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Pcsk2 A G 2: 143,801,111 E436G probably damaging Het
Pet100 T G 8: 3,621,764 probably null Het
Pira2 A G 7: 3,841,554 Y493H probably damaging Het
Prkdc C A 16: 15,739,471 R2213S probably benign Het
Prmt2 A G 10: 76,209,446 I342T possibly damaging Het
Psmc6 A G 14: 45,348,673 E381G possibly damaging Het
Rrm1 G A 7: 102,460,856 probably null Het
Sema3c A G 5: 17,727,632 D711G probably benign Het
Sgcb T C 5: 73,640,810 E103G possibly damaging Het
Sh3pxd2a A G 19: 47,267,409 S957P probably damaging Het
Slc26a2 A G 18: 61,199,417 V314A possibly damaging Het
Smarca5 G T 8: 80,711,743 H655N probably damaging Het
Sspo T A 6: 48,465,576 S2002T probably damaging Het
Sync T C 4: 129,293,751 L192P probably damaging Het
Ush2a T C 1: 188,358,603 M477T probably benign Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Vcam1 A G 3: 116,124,400 V304A probably damaging Het
Vmn2r120 T A 17: 57,525,973 M69L probably benign Het
Wdr11 A G 7: 129,624,791 D771G probably damaging Het
Other mutations in Vmn2r115
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r115 APN 17 23346206 missense possibly damaging 0.90
IGL00990:Vmn2r115 APN 17 23346176 missense probably benign 0.00
IGL00990:Vmn2r115 APN 17 23359349 missense probably benign 0.22
IGL00990:Vmn2r115 APN 17 23346339 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23346278 missense probably benign 0.14
IGL00990:Vmn2r115 APN 17 23346161 missense probably benign 0.03
IGL00990:Vmn2r115 APN 17 23359397 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23346371 nonsense probably null
IGL00990:Vmn2r115 APN 17 23346372 missense probably benign 0.30
IGL00990:Vmn2r115 APN 17 23356960 missense probably benign 0.00
IGL00990:Vmn2r115 APN 17 23346264 missense probably benign 0.19
IGL00990:Vmn2r115 APN 17 23359779 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23359824 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23348034 nonsense probably null
IGL01073:Vmn2r115 APN 17 23345997 missense probably benign 0.12
IGL01101:Vmn2r115 APN 17 23345997 missense probably benign 0.12
IGL01300:Vmn2r115 APN 17 23359781 missense probably damaging 1.00
IGL01415:Vmn2r115 APN 17 23359781 missense probably damaging 1.00
IGL02309:Vmn2r115 APN 17 23345139 missense probably benign 0.01
IGL02863:Vmn2r115 APN 17 23359283 missense probably damaging 0.97
R0023:Vmn2r115 UTSW 17 23346278 missense probably benign 0.14
R0197:Vmn2r115 UTSW 17 23359781 missense probably damaging 1.00
R0361:Vmn2r115 UTSW 17 23345222 missense probably benign 0.11
R0601:Vmn2r115 UTSW 17 23360100 missense probably null 0.51
R0676:Vmn2r115 UTSW 17 23346264 missense probably benign 0.19
R0685:Vmn2r115 UTSW 17 23359275 missense probably benign
R0865:Vmn2r115 UTSW 17 23346408 missense possibly damaging 0.65
R1124:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1145:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1146:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1207:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1266:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1318:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1367:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1376:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1376:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1420:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1469:Vmn2r115 UTSW 17 23346018 missense probably damaging 0.99
R1469:Vmn2r115 UTSW 17 23346018 missense probably damaging 0.99
R1604:Vmn2r115 UTSW 17 23345271 missense probably benign 0.12
R1645:Vmn2r115 UTSW 17 23346218 missense possibly damaging 0.69
R1646:Vmn2r115 UTSW 17 23359539 missense probably damaging 1.00
R1650:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1678:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1716:Vmn2r115 UTSW 17 23347821 missense probably benign
R1846:Vmn2r115 UTSW 17 23359383 missense probably damaging 1.00
R1847:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1885:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1887:Vmn2r115 UTSW 17 23346033 missense possibly damaging 0.91
R1937:Vmn2r115 UTSW 17 23359414 missense probably damaging 1.00
R2007:Vmn2r115 UTSW 17 23347953 missense possibly damaging 0.94
R2120:Vmn2r115 UTSW 17 23359323 missense probably damaging 1.00
R3161:Vmn2r115 UTSW 17 23357024 missense possibly damaging 0.82
R3780:Vmn2r115 UTSW 17 23345172 missense probably damaging 1.00
R3806:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R3982:Vmn2r115 UTSW 17 23359974 missense probably damaging 1.00
R4019:Vmn2r115 UTSW 17 23360043 missense probably damaging 1.00
R4039:Vmn2r115 UTSW 17 23345103 missense probably benign 0.26
R4087:Vmn2r115 UTSW 17 23346384 missense probably benign 0.35
R4089:Vmn2r115 UTSW 17 23346384 missense probably benign 0.35
R4379:Vmn2r115 UTSW 17 23345223 missense possibly damaging 0.95
R4417:Vmn2r115 UTSW 17 23345880 missense probably benign 0.02
R4601:Vmn2r115 UTSW 17 23346399 missense probably benign 0.01
R4874:Vmn2r115 UTSW 17 23359851 missense probably damaging 1.00
R5466:Vmn2r115 UTSW 17 23360056 missense probably damaging 1.00
R5613:Vmn2r115 UTSW 17 23345333 missense probably benign
R5821:Vmn2r115 UTSW 17 23347963 missense probably damaging 0.99
R6193:Vmn2r115 UTSW 17 23357009 missense probably benign 0.01
R6213:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R6290:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R6319:Vmn2r115 UTSW 17 23347903 missense possibly damaging 0.70
R6495:Vmn2r115 UTSW 17 23359598 missense probably benign 0.02
R6599:Vmn2r115 UTSW 17 23346032 missense probably benign 0.00
R6764:Vmn2r115 UTSW 17 23346072 missense probably damaging 1.00
R6970:Vmn2r115 UTSW 17 23346015 missense probably benign 0.23
R7023:Vmn2r115 UTSW 17 23359811 missense probably damaging 1.00
R7236:Vmn2r115 UTSW 17 23359602 missense probably benign 0.01
R7353:Vmn2r115 UTSW 17 23345913 missense possibly damaging 0.65
V5622:Vmn2r115 UTSW 17 23346227 missense probably damaging 1.00
V5622:Vmn2r115 UTSW 17 23359359 missense probably benign
X0023:Vmn2r115 UTSW 17 23359988 small deletion probably benign
X0033:Vmn2r115 UTSW 17 23359988 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AGGGTTGGTCATCTCAGACAATG -3'
(R):5'- GCATCCATTCCAGCTTTACCAG -3'

Sequencing Primer
(F):5'- TGGTCATCTCAGACAATGATCAAGG -3'
(R):5'- GATACTCATCTGGGCATTTGACAGAG -3'
Posted On2017-08-16