Incidental Mutation 'R6122:Sept2'
ID485749
Institutional Source Beutler Lab
Gene Symbol Sept2
Ensembl Gene ENSMUSG00000026276
Gene Nameseptin 2
SynonymsNedd5
MMRRC Submission 044269-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.820) question?
Stock #R6122 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location93478964-93510260 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93497376 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 45 (T45A)
Ref Sequence ENSEMBL: ENSMUSP00000127276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027495] [ENSMUST00000112912] [ENSMUST00000129211] [ENSMUST00000131175] [ENSMUST00000136182] [ENSMUST00000142401] [ENSMUST00000149532] [ENSMUST00000150931] [ENSMUST00000153826] [ENSMUST00000168776] [ENSMUST00000172165] [ENSMUST00000179353]
Predicted Effect probably damaging
Transcript: ENSMUST00000027495
AA Change: T85A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027495
Gene: ENSMUSG00000026276
AA Change: T85A

DomainStartEndE-ValueType
Pfam:Septin 34 313 1.1e-129 PFAM
Pfam:MMR_HSR1 39 242 3.2e-8 PFAM
low complexity region 330 348 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112912
AA Change: T85A

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108534
Gene: ENSMUSG00000026276
AA Change: T85A

DomainStartEndE-ValueType
Pfam:Septin 34 221 4.8e-87 PFAM
Pfam:AIG1 38 130 1.1e-6 PFAM
Pfam:MMR_HSR1 39 213 1.2e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129211
AA Change: T85A

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120511
Gene: ENSMUSG00000026276
AA Change: T85A

DomainStartEndE-ValueType
Pfam:Septin 34 213 4.9e-85 PFAM
Pfam:AIG1 38 131 9.9e-7 PFAM
Pfam:MMR_HSR1 39 211 1.2e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131175
AA Change: T85A

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120694
Gene: ENSMUSG00000026276
AA Change: T85A

DomainStartEndE-ValueType
Pfam:Septin 34 212 6.5e-85 PFAM
Pfam:AIG1 38 131 9.8e-7 PFAM
Pfam:MMR_HSR1 39 211 1.1e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000136182
AA Change: T45A

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118621
Gene: ENSMUSG00000026276
AA Change: T45A

DomainStartEndE-ValueType
Pfam:AIG1 1 96 1.4e-6 PFAM
Pfam:MMR_HSR1 1 103 1.3e-8 PFAM
Pfam:Septin 1 107 6.4e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000142401
AA Change: T115A

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121974
Gene: ENSMUSG00000026276
AA Change: T115A

DomainStartEndE-ValueType
Pfam:Septin 64 177 4.9e-49 PFAM
Pfam:AIG1 68 159 2.3e-7 PFAM
Pfam:MMR_HSR1 69 172 1.1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149532
AA Change: T85A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115536
Gene: ENSMUSG00000026276
AA Change: T85A

DomainStartEndE-ValueType
Pfam:Septin 34 120 7e-35 PFAM
Pfam:GTP_EFTU 37 110 9.5e-6 PFAM
Pfam:AIG1 38 120 3.4e-7 PFAM
Pfam:Ras 39 115 1.2e-5 PFAM
Pfam:MMR_HSR1 39 118 2.1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150931
AA Change: T85A

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117517
Gene: ENSMUSG00000026276
AA Change: T85A

DomainStartEndE-ValueType
Pfam:Septin 34 221 4.8e-87 PFAM
Pfam:AIG1 38 130 1.1e-6 PFAM
Pfam:MMR_HSR1 39 213 1.2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152778
Predicted Effect probably benign
Transcript: ENSMUST00000153826
SMART Domains Protein: ENSMUSP00000114614
Gene: ENSMUSG00000026276

DomainStartEndE-ValueType
Pfam:Septin 34 77 4.7e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168776
AA Change: T85A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132850
Gene: ENSMUSG00000116048
AA Change: T85A

DomainStartEndE-ValueType
Pfam:Septin 34 313 1.4e-129 PFAM
Pfam:MMR_HSR1 39 240 1.2e-8 PFAM
low complexity region 330 348 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172165
AA Change: T45A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127276
Gene: ENSMUSG00000116048
AA Change: T45A

DomainStartEndE-ValueType
Pfam:MMR_HSR1 1 203 5.8e-8 PFAM
Pfam:Septin 1 273 1.5e-125 PFAM
coiled coil region 277 308 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179353
AA Change: T85A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136366
Gene: ENSMUSG00000116048
AA Change: T85A

DomainStartEndE-ValueType
Pfam:Septin 34 313 1.1e-129 PFAM
Pfam:MMR_HSR1 39 242 3.2e-8 PFAM
low complexity region 330 348 N/A INTRINSIC
Meta Mutation Damage Score 0.366 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.8%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,252 *301W probably null Het
Abat A G 16: 8,605,550 I236V probably benign Het
Abca8a T C 11: 110,070,423 T558A probably benign Het
Ace3 A C 11: 105,994,938 M57L probably benign Het
Adgrg1 T C 8: 95,002,501 S18P probably benign Het
Ahi1 A G 10: 21,058,165 D60G probably benign Het
Ap4e1 T A 2: 127,028,160 probably null Het
Arnt2 C A 7: 84,361,565 K34N probably damaging Het
Ascc3 T A 10: 50,617,925 M152K probably benign Het
AW551984 A T 9: 39,593,755 F480L probably benign Het
Blvrb G A 7: 27,459,348 A58T possibly damaging Het
Bpifa1 C T 2: 154,143,972 T69I probably benign Het
Cacna1g T A 11: 94,430,171 M1366L probably benign Het
Ccdc82 A G 9: 13,266,412 I361V probably benign Het
Clca4b T A 3: 144,926,166 I193F possibly damaging Het
Crb1 A T 1: 139,248,948 Y371* probably null Het
Cul9 T C 17: 46,521,928 D1363G possibly damaging Het
Cyp2j8 C T 4: 96,444,640 A490T probably benign Het
D430041D05Rik A T 2: 104,256,292 S780T probably benign Het
Fzd5 G T 1: 64,735,656 C315* probably null Het
Gabrr1 T C 4: 33,161,695 S340P probably damaging Het
Galnt7 T C 8: 57,526,166 D641G probably damaging Het
Gm7133 A G 1: 97,183,223 noncoding transcript Het
Heatr5b A G 17: 78,813,173 L774P possibly damaging Het
Itch T A 2: 155,174,065 S157T probably benign Het
Itgam A C 7: 128,085,652 D398A probably damaging Het
Kalrn G T 16: 33,985,191 L2659M possibly damaging Het
Kcnj14 C A 7: 45,819,451 R210L possibly damaging Het
Kmt2d T C 15: 98,860,692 probably benign Het
Krt2 G C 15: 101,815,914 T305S probably damaging Het
Mcm3ap A G 10: 76,506,607 N1645D probably damaging Het
Naf1 T A 8: 66,883,444 I341K probably damaging Het
Nbea G T 3: 56,029,896 H765N probably damaging Het
Ncapd3 A G 9: 27,063,982 I776V probably benign Het
Neo1 A T 9: 58,917,008 D712E probably benign Het
Neu1 G A 17: 34,934,754 V385I probably benign Het
Olfr114 C A 17: 37,589,926 R142S probably benign Het
Olfr575 C A 7: 102,954,804 G273C probably damaging Het
Olfr575 A G 7: 102,955,530 Y24H probably benign Het
Pgghg A C 7: 140,943,395 T196P possibly damaging Het
Pira2 A T 7: 3,842,446 V313E probably damaging Het
Pkd1l2 T C 8: 117,082,368 R28G probably benign Het
Pkhd1l1 T C 15: 44,557,940 S3035P probably damaging Het
Ppp1r9a T A 6: 4,905,509 N21K probably damaging Het
Prune1 T C 3: 95,262,243 D216G probably benign Het
Ptpn23 G T 9: 110,387,825 probably benign Het
Ranbp2 T A 10: 58,465,529 M668K probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpsa G T 9: 120,131,036 V222L probably benign Het
Slc12a8 A T 16: 33,625,014 D260V probably damaging Het
Srrm2 G T 17: 23,820,356 M2087I possibly damaging Het
Tg T C 15: 66,828,457 L88P probably damaging Het
Tns1 A G 1: 73,952,419 probably null Het
Topbp1 A T 9: 103,346,961 D1429V probably benign Het
Tprg A G 16: 25,422,401 probably null Het
Trit1 T C 4: 123,039,468 I66T possibly damaging Het
Usf3 A T 16: 44,217,307 I717L probably damaging Het
Other mutations in Sept2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Sept2 APN 1 93499142 missense probably damaging 1.00
IGL01909:Sept2 APN 1 93499101 missense probably damaging 1.00
IGL02504:Sept2 APN 1 93500481 missense probably benign 0.06
R0136:Sept2 UTSW 1 93507050 missense possibly damaging 0.57
R0140:Sept2 UTSW 1 93501639 missense probably damaging 1.00
R0335:Sept2 UTSW 1 93495599 missense probably damaging 1.00
R0538:Sept2 UTSW 1 93501623 missense probably damaging 1.00
R1370:Sept2 UTSW 1 93499106 missense probably damaging 1.00
R1463:Sept2 UTSW 1 93499315 missense possibly damaging 0.79
R4832:Sept2 UTSW 1 93499127 missense probably damaging 0.98
R5443:Sept2 UTSW 1 93497452 missense possibly damaging 0.95
R5845:Sept2 UTSW 1 93499035 unclassified probably null
R5898:Sept2 UTSW 1 93479301 missense probably benign
R6542:Sept2 UTSW 1 93497466 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTTTCTGAGACCTTCCAAGTCATC -3'
(R):5'- GATCCGGCAACTTTAAGTGTTG -3'

Sequencing Primer
(F):5'- TTGAACTCAGAAATCTGCCTGC -3'
(R):5'- CAACTTTAAGTGTTGCTAACATTGTC -3'
Posted On2017-08-16