Incidental Mutation 'R6122:Clca4b'
ID485757
Institutional Source Beutler Lab
Gene Symbol Clca4b
Ensembl Gene ENSMUSG00000074195
Gene Namechloride channel accessory 4B
SynonymsAI747448
MMRRC Submission 044269-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R6122 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location144910921-144932529 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 144926166 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 193 (I193F)
Ref Sequence ENSEMBL: ENSMUSP00000096149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098549]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098549
AA Change: I193F

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000096149
Gene: ENSMUSG00000074195
AA Change: I193F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWA 306 480 1.03e-15 SMART
Blast:VWA 513 552 6e-16 BLAST
Blast:FN3 757 838 5e-35 BLAST
low complexity region 882 906 N/A INTRINSIC
Meta Mutation Damage Score 0.244 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.8%
Validation Efficiency 98% (57/58)
MGI Phenotype PHENOTYPE: No notable phenotype was detected in a high throughput screen of homozyogus mutant null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,252 *301W probably null Het
Abat A G 16: 8,605,550 I236V probably benign Het
Abca8a T C 11: 110,070,423 T558A probably benign Het
Ace3 A C 11: 105,994,938 M57L probably benign Het
Adgrg1 T C 8: 95,002,501 S18P probably benign Het
Ahi1 A G 10: 21,058,165 D60G probably benign Het
Ap4e1 T A 2: 127,028,160 probably null Het
Arnt2 C A 7: 84,361,565 K34N probably damaging Het
Ascc3 T A 10: 50,617,925 M152K probably benign Het
AW551984 A T 9: 39,593,755 F480L probably benign Het
Blvrb G A 7: 27,459,348 A58T possibly damaging Het
Bpifa1 C T 2: 154,143,972 T69I probably benign Het
Cacna1g T A 11: 94,430,171 M1366L probably benign Het
Ccdc82 A G 9: 13,266,412 I361V probably benign Het
Crb1 A T 1: 139,248,948 Y371* probably null Het
Cul9 T C 17: 46,521,928 D1363G possibly damaging Het
Cyp2j8 C T 4: 96,444,640 A490T probably benign Het
D430041D05Rik A T 2: 104,256,292 S780T probably benign Het
Fzd5 G T 1: 64,735,656 C315* probably null Het
Gabrr1 T C 4: 33,161,695 S340P probably damaging Het
Galnt7 T C 8: 57,526,166 D641G probably damaging Het
Gm7133 A G 1: 97,183,223 noncoding transcript Het
Heatr5b A G 17: 78,813,173 L774P possibly damaging Het
Itch T A 2: 155,174,065 S157T probably benign Het
Itgam A C 7: 128,085,652 D398A probably damaging Het
Kalrn G T 16: 33,985,191 L2659M possibly damaging Het
Kcnj14 C A 7: 45,819,451 R210L possibly damaging Het
Kmt2d T C 15: 98,860,692 probably benign Het
Krt2 G C 15: 101,815,914 T305S probably damaging Het
Mcm3ap A G 10: 76,506,607 N1645D probably damaging Het
Naf1 T A 8: 66,883,444 I341K probably damaging Het
Nbea G T 3: 56,029,896 H765N probably damaging Het
Ncapd3 A G 9: 27,063,982 I776V probably benign Het
Neo1 A T 9: 58,917,008 D712E probably benign Het
Neu1 G A 17: 34,934,754 V385I probably benign Het
Olfr114 C A 17: 37,589,926 R142S probably benign Het
Olfr575 C A 7: 102,954,804 G273C probably damaging Het
Olfr575 A G 7: 102,955,530 Y24H probably benign Het
Pgghg A C 7: 140,943,395 T196P possibly damaging Het
Pira2 A T 7: 3,842,446 V313E probably damaging Het
Pkd1l2 T C 8: 117,082,368 R28G probably benign Het
Pkhd1l1 T C 15: 44,557,940 S3035P probably damaging Het
Ppp1r9a T A 6: 4,905,509 N21K probably damaging Het
Prune1 T C 3: 95,262,243 D216G probably benign Het
Ptpn23 G T 9: 110,387,825 probably benign Het
Ranbp2 T A 10: 58,465,529 M668K probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpsa G T 9: 120,131,036 V222L probably benign Het
Sept2 A G 1: 93,497,376 T45A probably damaging Het
Slc12a8 A T 16: 33,625,014 D260V probably damaging Het
Srrm2 G T 17: 23,820,356 M2087I possibly damaging Het
Tg T C 15: 66,828,457 L88P probably damaging Het
Tns1 A G 1: 73,952,419 probably null Het
Topbp1 A T 9: 103,346,961 D1429V probably benign Het
Tprg A G 16: 25,422,401 probably null Het
Trit1 T C 4: 123,039,468 I66T possibly damaging Het
Usf3 A T 16: 44,217,307 I717L probably damaging Het
Other mutations in Clca4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Clca4b APN 3 144932391 missense probably benign 0.00
IGL00391:Clca4b APN 3 144915561 missense possibly damaging 0.81
IGL00576:Clca4b APN 3 144925347 missense probably damaging 1.00
IGL01484:Clca4b APN 3 144928235 missense probably benign 0.02
IGL01539:Clca4b APN 3 144926157 missense probably benign
IGL01726:Clca4b APN 3 144928342 missense probably damaging 1.00
IGL01903:Clca4b APN 3 144928259 missense probably damaging 0.98
IGL01967:Clca4b APN 3 144928190 splice site probably benign
IGL02002:Clca4b APN 3 144932433 missense probably benign 0.00
IGL02323:Clca4b APN 3 144913321 missense probably benign
IGL02379:Clca4b APN 3 144921858 missense probably benign 0.00
IGL02638:Clca4b APN 3 144926178 missense probably damaging 1.00
IGL02859:Clca4b APN 3 144912039 missense probably benign
R0110:Clca4b UTSW 3 144913351 missense probably damaging 1.00
R0266:Clca4b UTSW 3 144922786 missense probably damaging 1.00
R0311:Clca4b UTSW 3 144932496 missense probably benign 0.04
R0348:Clca4b UTSW 3 144921980 missense probably damaging 0.96
R0450:Clca4b UTSW 3 144913351 missense probably damaging 1.00
R0510:Clca4b UTSW 3 144913351 missense probably damaging 1.00
R0538:Clca4b UTSW 3 144921956 missense probably benign 0.15
R0551:Clca4b UTSW 3 144928626 missense probably damaging 1.00
R0552:Clca4b UTSW 3 144916775 missense probably benign
R0570:Clca4b UTSW 3 144925349 missense probably benign 0.01
R0591:Clca4b UTSW 3 144915592 nonsense probably null
R0627:Clca4b UTSW 3 144928259 missense probably benign 0.20
R0729:Clca4b UTSW 3 144928350 splice site probably benign
R0844:Clca4b UTSW 3 144916771 missense probably damaging 0.96
R0964:Clca4b UTSW 3 144915576 missense probably benign
R1388:Clca4b UTSW 3 144916654 missense probably benign
R1479:Clca4b UTSW 3 144915468 missense probably damaging 0.99
R1603:Clca4b UTSW 3 144922019 missense probably benign 0.20
R2045:Clca4b UTSW 3 144925163 missense probably damaging 1.00
R2162:Clca4b UTSW 3 144928587 missense probably benign 0.19
R2185:Clca4b UTSW 3 144928556 missense probably damaging 1.00
R2241:Clca4b UTSW 3 144911226 missense probably benign 0.00
R2300:Clca4b UTSW 3 144916671 missense probably benign 0.02
R2321:Clca4b UTSW 3 144932373 missense probably benign 0.00
R2359:Clca4b UTSW 3 144925242 missense probably damaging 0.96
R3105:Clca4b UTSW 3 144916671 missense probably benign 0.02
R3151:Clca4b UTSW 3 144915511 missense probably benign 0.05
R3158:Clca4b UTSW 3 144912117 missense probably benign 0.04
R3177:Clca4b UTSW 3 144911359 missense probably benign 0.15
R3277:Clca4b UTSW 3 144911359 missense probably benign 0.15
R3981:Clca4b UTSW 3 144926036 missense probably benign 0.27
R4601:Clca4b UTSW 3 144927184 missense possibly damaging 0.81
R4646:Clca4b UTSW 3 144928525 missense probably benign 0.00
R4647:Clca4b UTSW 3 144928525 missense probably benign 0.00
R4696:Clca4b UTSW 3 144911385 missense probably benign 0.00
R4893:Clca4b UTSW 3 144925173 missense possibly damaging 0.67
R4998:Clca4b UTSW 3 144915508 missense probably benign 0.00
R5053:Clca4b UTSW 3 144911121 missense probably benign 0.01
R5060:Clca4b UTSW 3 144911506 missense probably damaging 1.00
R5319:Clca4b UTSW 3 144925179 missense possibly damaging 0.85
R5409:Clca4b UTSW 3 144916691 nonsense probably null
R5534:Clca4b UTSW 3 144915466 missense probably damaging 1.00
R5578:Clca4b UTSW 3 144932435 missense probably benign 0.04
R5667:Clca4b UTSW 3 144921863 missense probably benign
R5671:Clca4b UTSW 3 144921863 missense probably benign
R5715:Clca4b UTSW 3 144913257 missense probably benign 0.01
R5875:Clca4b UTSW 3 144922889 missense probably benign 0.38
R5876:Clca4b UTSW 3 144912060 missense possibly damaging 0.91
R6294:Clca4b UTSW 3 144925185 missense probably null
R6408:Clca4b UTSW 3 144919275 missense probably benign 0.00
R6418:Clca4b UTSW 3 144928235 missense probably benign 0.02
R6458:Clca4b UTSW 3 144911327 missense possibly damaging 0.77
R6536:Clca4b UTSW 3 144916729 missense possibly damaging 0.66
R6567:Clca4b UTSW 3 144932339 missense possibly damaging 0.96
R6781:Clca4b UTSW 3 144922801 missense probably benign
R6799:Clca4b UTSW 3 144915627 splice site probably null
R7046:Clca4b UTSW 3 144915606 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCTGGACACAGTGACTGG -3'
(R):5'- GTGTGTGACTGGAGATACCC -3'

Sequencing Primer
(F):5'- TCTGGACACAGTGACTGGTATAC -3'
(R):5'- TGACTGGAGATACCCCTTTGGC -3'
Posted On2017-08-16