Incidental Mutation 'R6122:Neo1'
ID485779
Institutional Source Beutler Lab
Gene Symbol Neo1
Ensembl Gene ENSMUSG00000032340
Gene Nameneogenin
Synonyms2610028H22Rik, D930014N22Rik, Igdcc2
MMRRC Submission 044269-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6122 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location58874687-59036441 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58917008 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 712 (D712E)
Ref Sequence ENSEMBL: ENSMUSP00000150600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068664] [ENSMUST00000214547]
Predicted Effect probably benign
Transcript: ENSMUST00000068664
AA Change: D712E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000063656
Gene: ENSMUSG00000032340
AA Change: D712E

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
IGc2 76 147 9.49e-5 SMART
IGc2 175 239 4.43e-5 SMART
IGc2 272 338 6.15e-13 SMART
IGc2 364 428 7.76e-10 SMART
low complexity region 446 458 N/A INTRINSIC
FN3 470 553 8.23e-12 SMART
FN3 570 649 1.78e-16 SMART
FN3 665 749 1.54e-11 SMART
FN3 770 849 5.27e-10 SMART
FN3 885 970 7.63e-7 SMART
FN3 986 1072 2.78e-9 SMART
transmembrane domain 1136 1158 N/A INTRINSIC
Pfam:Neogenin_C 1189 1492 1.9e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214547
AA Change: D712E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215026
Predicted Effect probably benign
Transcript: ENSMUST00000216964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217545
Meta Mutation Damage Score 0.232 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.8%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface protein that is a member of the immunoglobulin superfamily. The encoded protein consists of four N-terminal immunoglobulin-like domains, six fibronectin type III domains, a transmembrane domain and a C-terminal internal domain that shares homology with the tumor suppressor candidate gene DCC. This protein may be involved in cell growth and differentiation and in cell-cell adhesion. Defects in this gene are associated with cell proliferation in certain cancers. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a gene trap allele display perinatal lethality and abnormal trigeminal nerve development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,252 *301W probably null Het
Abat A G 16: 8,605,550 I236V probably benign Het
Abca8a T C 11: 110,070,423 T558A probably benign Het
Ace3 A C 11: 105,994,938 M57L probably benign Het
Adgrg1 T C 8: 95,002,501 S18P probably benign Het
Ahi1 A G 10: 21,058,165 D60G probably benign Het
Ap4e1 T A 2: 127,028,160 probably null Het
Arnt2 C A 7: 84,361,565 K34N probably damaging Het
Ascc3 T A 10: 50,617,925 M152K probably benign Het
AW551984 A T 9: 39,593,755 F480L probably benign Het
Blvrb G A 7: 27,459,348 A58T possibly damaging Het
Bpifa1 C T 2: 154,143,972 T69I probably benign Het
Cacna1g T A 11: 94,430,171 M1366L probably benign Het
Ccdc82 A G 9: 13,266,412 I361V probably benign Het
Clca4b T A 3: 144,926,166 I193F possibly damaging Het
Crb1 A T 1: 139,248,948 Y371* probably null Het
Cul9 T C 17: 46,521,928 D1363G possibly damaging Het
Cyp2j8 C T 4: 96,444,640 A490T probably benign Het
D430041D05Rik A T 2: 104,256,292 S780T probably benign Het
Fzd5 G T 1: 64,735,656 C315* probably null Het
Gabrr1 T C 4: 33,161,695 S340P probably damaging Het
Galnt7 T C 8: 57,526,166 D641G probably damaging Het
Gm7133 A G 1: 97,183,223 noncoding transcript Het
Heatr5b A G 17: 78,813,173 L774P possibly damaging Het
Itch T A 2: 155,174,065 S157T probably benign Het
Itgam A C 7: 128,085,652 D398A probably damaging Het
Kalrn G T 16: 33,985,191 L2659M possibly damaging Het
Kcnj14 C A 7: 45,819,451 R210L possibly damaging Het
Kmt2d T C 15: 98,860,692 probably benign Het
Krt2 G C 15: 101,815,914 T305S probably damaging Het
Mcm3ap A G 10: 76,506,607 N1645D probably damaging Het
Naf1 T A 8: 66,883,444 I341K probably damaging Het
Nbea G T 3: 56,029,896 H765N probably damaging Het
Ncapd3 A G 9: 27,063,982 I776V probably benign Het
Neu1 G A 17: 34,934,754 V385I probably benign Het
Olfr114 C A 17: 37,589,926 R142S probably benign Het
Olfr575 C A 7: 102,954,804 G273C probably damaging Het
Olfr575 A G 7: 102,955,530 Y24H probably benign Het
Pgghg A C 7: 140,943,395 T196P possibly damaging Het
Pira2 A T 7: 3,842,446 V313E probably damaging Het
Pkd1l2 T C 8: 117,082,368 R28G probably benign Het
Pkhd1l1 T C 15: 44,557,940 S3035P probably damaging Het
Ppp1r9a T A 6: 4,905,509 N21K probably damaging Het
Prune1 T C 3: 95,262,243 D216G probably benign Het
Ptpn23 G T 9: 110,387,825 probably benign Het
Ranbp2 T A 10: 58,465,529 M668K probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpsa G T 9: 120,131,036 V222L probably benign Het
Sept2 A G 1: 93,497,376 T45A probably damaging Het
Slc12a8 A T 16: 33,625,014 D260V probably damaging Het
Srrm2 G T 17: 23,820,356 M2087I possibly damaging Het
Tg T C 15: 66,828,457 L88P probably damaging Het
Tns1 A G 1: 73,952,419 probably null Het
Topbp1 A T 9: 103,346,961 D1429V probably benign Het
Tprg A G 16: 25,422,401 probably null Het
Trit1 T C 4: 123,039,468 I66T possibly damaging Het
Usf3 A T 16: 44,217,307 I717L probably damaging Het
Other mutations in Neo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Neo1 APN 9 58921919 splice site probably benign
IGL00885:Neo1 APN 9 58888463 missense probably damaging 1.00
IGL01103:Neo1 APN 9 58880799 missense possibly damaging 0.60
IGL01322:Neo1 APN 9 58907085 missense possibly damaging 0.68
IGL02216:Neo1 APN 9 58917053 missense probably damaging 0.96
IGL02327:Neo1 APN 9 58903088 missense probably benign 0.08
IGL02392:Neo1 APN 9 58925811 missense possibly damaging 0.49
IGL02458:Neo1 APN 9 58893867 splice site probably benign
IGL03057:Neo1 APN 9 58878059 missense probably damaging 1.00
IGL03091:Neo1 APN 9 58978668 missense probably damaging 0.98
IGL03193:Neo1 APN 9 58908484 missense probably damaging 1.00
R0097:Neo1 UTSW 9 58882021 intron probably benign
R0419:Neo1 UTSW 9 58990180 splice site probably benign
R0571:Neo1 UTSW 9 58985786 missense probably benign
R0646:Neo1 UTSW 9 58931034 missense probably damaging 1.00
R0736:Neo1 UTSW 9 58917081 missense possibly damaging 0.78
R0739:Neo1 UTSW 9 58921877 missense probably benign 0.22
R1636:Neo1 UTSW 9 58913277 missense probably damaging 1.00
R1694:Neo1 UTSW 9 58880603 missense probably damaging 1.00
R1827:Neo1 UTSW 9 58917031 nonsense probably null
R1927:Neo1 UTSW 9 58990385 missense probably benign 0.12
R2354:Neo1 UTSW 9 58985634 missense probably benign
R2365:Neo1 UTSW 9 58956003 missense probably benign
R3156:Neo1 UTSW 9 58888979 splice site probably null
R3552:Neo1 UTSW 9 58893878 missense probably damaging 1.00
R3829:Neo1 UTSW 9 58913169 missense possibly damaging 0.58
R4477:Neo1 UTSW 9 58877299 missense probably damaging 0.99
R4613:Neo1 UTSW 9 58889041 missense possibly damaging 0.94
R5023:Neo1 UTSW 9 58990271 missense probably damaging 1.00
R5046:Neo1 UTSW 9 58893911 missense possibly damaging 0.77
R5057:Neo1 UTSW 9 58990271 missense probably damaging 1.00
R5323:Neo1 UTSW 9 58906648 critical splice donor site probably null
R5394:Neo1 UTSW 9 58990234 missense probably benign 0.10
R5470:Neo1 UTSW 9 58931067 missense probably damaging 1.00
R5473:Neo1 UTSW 9 58880843 missense possibly damaging 0.88
R5500:Neo1 UTSW 9 58917054 missense possibly damaging 0.94
R5503:Neo1 UTSW 9 58985650 missense possibly damaging 0.67
R6191:Neo1 UTSW 9 58889029 missense probably damaging 1.00
R6431:Neo1 UTSW 9 58907071 missense probably benign 0.27
R6560:Neo1 UTSW 9 58880601 missense possibly damaging 0.95
R6658:Neo1 UTSW 9 58921849 missense probably benign 0.14
R6772:Neo1 UTSW 9 58902976 missense probably damaging 1.00
R6912:Neo1 UTSW 9 58917052 missense probably benign 0.00
R7061:Neo1 UTSW 9 58990441 missense possibly damaging 0.95
R7145:Neo1 UTSW 9 58889179 missense probably damaging 1.00
R7156:Neo1 UTSW 9 58902923 missense probably damaging 1.00
X0063:Neo1 UTSW 9 58990298 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCAACTCCTCAGCGATGGAG -3'
(R):5'- GGGTTTTATAGCATGTACAGTCAG -3'

Sequencing Primer
(F):5'- GGAGGAATCCACCAGAGTATTTTCC -3'
(R):5'- TGTACAGTCAGGAACAGCCCTTTG -3'
Posted On2017-08-16