Incidental Mutation 'R6123:Gm13084'
ID485823
Institutional Source Beutler Lab
Gene Symbol Gm13084
Ensembl Gene ENSMUSG00000059218
Gene Namepredicted gene 13084
Synonyms
MMRRC Submission 044270-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R6123 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location143809245-143816093 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 143812764 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 53 (M53K)
Ref Sequence ENSEMBL: ENSMUSP00000101395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075045] [ENSMUST00000105769]
Predicted Effect probably benign
Transcript: ENSMUST00000075045
AA Change: M53K

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000074557
Gene: ENSMUSG00000059218
AA Change: M53K

DomainStartEndE-ValueType
SCOP:d1a4ya_ 222 409 9e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105769
AA Change: M53K

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101395
Gene: ENSMUSG00000059218
AA Change: M53K

DomainStartEndE-ValueType
low complexity region 223 238 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137635
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T C 2: 23,230,122 Y235H possibly damaging Het
Acot7 A G 4: 152,199,945 E24G probably benign Het
Ankrd34b A G 13: 92,439,076 E272G probably damaging Het
Arhgef18 A T 8: 3,437,091 N270I probably damaging Het
AU040320 A G 4: 126,869,386 probably benign Het
BC022687 T C 12: 112,810,910 F153L probably damaging Het
Btnl10 C A 11: 58,920,304 S151Y probably damaging Het
Ccdc146 C A 5: 21,305,597 R504I possibly damaging Het
Ckmt1 C G 2: 121,363,579 R408G probably benign Het
Cyp2j6 A T 4: 96,518,029 *502R probably null Het
Dido1 A T 2: 180,683,967 V476E probably benign Het
Dnah2 T C 11: 69,518,359 K398E probably benign Het
E130308A19Rik A G 4: 59,737,565 Y392C probably damaging Het
Esf1 T A 2: 140,168,389 D9V probably benign Het
Fam168a A G 7: 100,824,150 Q82R probably damaging Het
Fastkd3 C T 13: 68,590,218 Q32* probably null Het
Gm12394 A G 4: 42,793,065 S356P possibly damaging Het
Gm14496 T A 2: 181,991,227 M1K probably null Het
Gm6665 A G 18: 31,819,884 M79T probably benign Het
Gna15 A G 10: 81,509,344 L229P probably damaging Het
Herc1 A G 9: 66,497,250 T4451A probably damaging Het
Igf2bp1 A G 11: 95,975,296 V122A probably damaging Het
Ighv5-4 A T 12: 113,597,693 S36T probably damaging Het
Ints3 A G 3: 90,413,554 V186A probably benign Het
Jrk A G 15: 74,706,680 I252T possibly damaging Het
Kcnh5 T C 12: 75,087,591 S395G probably benign Het
Kcnt2 C T 1: 140,362,980 P103S probably damaging Het
Klra10 T C 6: 130,279,376 K105R probably benign Het
P4ha1 A T 10: 59,350,527 K276I possibly damaging Het
Pcyox1 A G 6: 86,388,928 S435P possibly damaging Het
R3hdm1 A T 1: 128,169,036 N103I probably damaging Het
Rnf213 T C 11: 119,411,513 V421A probably damaging Het
Rnpc3 A T 3: 113,609,056 probably null Het
Scaf11 A G 15: 96,420,454 S410P probably benign Het
Slc16a1 A G 3: 104,653,194 T272A probably benign Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Slitrk3 T C 3: 73,049,762 D559G probably damaging Het
Sntb2 G A 8: 106,981,225 G207D probably damaging Het
Spdye4a T C 5: 143,225,718 I30M possibly damaging Het
Thumpd1 A T 7: 119,717,009 V239E probably damaging Het
Tnfsf15 T C 4: 63,744,925 S54G probably benign Het
Tor1aip1 A G 1: 156,007,205 I299T probably damaging Het
Tpst2 C T 5: 112,308,218 R208C probably damaging Het
Tubgcp2 T C 7: 140,007,597 Y285C probably damaging Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Washc5 A G 15: 59,335,110 S1105P probably damaging Het
Other mutations in Gm13084
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Gm13084 APN 4 143812723 missense probably benign 0.32
IGL01075:Gm13084 APN 4 143811646 missense possibly damaging 0.47
IGL02705:Gm13084 APN 4 143810802 missense probably damaging 1.00
IGL03011:Gm13084 APN 4 143811760 missense possibly damaging 0.95
PIT4498001:Gm13084 UTSW 4 143812836 missense possibly damaging 0.63
R0268:Gm13084 UTSW 4 143810768 missense probably damaging 1.00
R0344:Gm13084 UTSW 4 143810768 missense probably damaging 1.00
R0390:Gm13084 UTSW 4 143811699 missense probably benign 0.09
R0597:Gm13084 UTSW 4 143812652 missense probably damaging 0.98
R0646:Gm13084 UTSW 4 143812585 missense possibly damaging 0.83
R0927:Gm13084 UTSW 4 143812808 missense probably benign 0.05
R0973:Gm13084 UTSW 4 143811858 missense probably damaging 1.00
R1851:Gm13084 UTSW 4 143812826 missense probably benign 0.33
R1852:Gm13084 UTSW 4 143812826 missense probably benign 0.33
R3699:Gm13084 UTSW 4 143810352 missense probably benign 0.05
R3705:Gm13084 UTSW 4 143811775 missense probably benign 0.06
R3845:Gm13084 UTSW 4 143811975 missense probably damaging 0.96
R4035:Gm13084 UTSW 4 143810456 missense probably benign 0.08
R4044:Gm13084 UTSW 4 143811600 missense probably benign 0.34
R4439:Gm13084 UTSW 4 143811573 missense possibly damaging 0.49
R4660:Gm13084 UTSW 4 143811865 missense probably benign 0.19
R4770:Gm13084 UTSW 4 143811949 missense probably damaging 0.96
R4838:Gm13084 UTSW 4 143810805 nonsense probably null
R5534:Gm13084 UTSW 4 143812599 nonsense probably null
R5691:Gm13084 UTSW 4 143812009 missense probably benign 0.44
R5893:Gm13084 UTSW 4 143810468 missense probably damaging 1.00
R6285:Gm13084 UTSW 4 143816039 missense probably damaging 1.00
R6886:Gm13084 UTSW 4 143812762 missense probably benign 0.29
R7105:Gm13084 UTSW 4 143810771 missense probably benign 0.04
R7135:Gm13084 UTSW 4 143810663 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTACCTGGAAAGAACTGG -3'
(R):5'- TGATCCAAGCCCCATATTTACC -3'

Sequencing Primer
(F):5'- CCCTACCTGGAAAGAACTGGTTTTG -3'
(R):5'- CCTGTCTGGGATAAAAGACTTGC -3'
Posted On2017-08-16