Incidental Mutation 'R6123:Acot7'
ID485824
Institutional Source Beutler Lab
Gene Symbol Acot7
Ensembl Gene ENSMUSG00000028937
Gene Nameacyl-CoA thioesterase 7
Synonyms2410041A17Rik, Bach, AU014716
MMRRC Submission 044270-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R6123 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location152178134-152271855 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 152199945 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 24 (E24G)
Ref Sequence ENSEMBL: ENSMUSP00000101277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030779] [ENSMUST00000075363] [ENSMUST00000105652] [ENSMUST00000167926]
Predicted Effect probably benign
Transcript: ENSMUST00000030779
SMART Domains Protein: ENSMUSP00000030779
Gene: ENSMUSG00000028937

DomainStartEndE-ValueType
Pfam:4HBT 69 152 1e-16 PFAM
Pfam:4HBT 243 318 4.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075363
SMART Domains Protein: ENSMUSP00000074827
Gene: ENSMUSG00000028937

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
low complexity region 30 36 N/A INTRINSIC
Pfam:4HBT 67 150 1.2e-16 PFAM
Pfam:4HBT 241 316 5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105652
AA Change: E24G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101277
Gene: ENSMUSG00000028937
AA Change: E24G

DomainStartEndE-ValueType
Pfam:4HBT 38 121 1.1e-16 PFAM
Pfam:4HBT 212 287 4.4e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144733
Predicted Effect probably benign
Transcript: ENSMUST00000167926
SMART Domains Protein: ENSMUSP00000129121
Gene: ENSMUSG00000028937

DomainStartEndE-ValueType
Pfam:4HBT 72 155 2.3e-17 PFAM
Pfam:4HBT 246 320 1.2e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184331
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl coenzyme family. The encoded protein hydrolyzes the CoA thioester of palmitoyl-CoA and other long-chain fatty acids. Decreased expression of this gene may be associated with mesial temporal lobe epilepsy. Alternatively spliced transcript variants encoding distinct isoforms with different subcellular locations have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a floxed allele activated in neurons exhibit abnormal glucose and lipid homeostasis, altered metabolism, increaased adiposity, decreased lean mass, progressive neurodegeneration, and neurological defects in aged mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T C 2: 23,230,122 Y235H possibly damaging Het
Ankrd34b A G 13: 92,439,076 E272G probably damaging Het
Arhgef18 A T 8: 3,437,091 N270I probably damaging Het
AU040320 A G 4: 126,869,386 probably benign Het
BC022687 T C 12: 112,810,910 F153L probably damaging Het
Btnl10 C A 11: 58,920,304 S151Y probably damaging Het
Ccdc146 C A 5: 21,305,597 R504I possibly damaging Het
Ckmt1 C G 2: 121,363,579 R408G probably benign Het
Cyp2j6 A T 4: 96,518,029 *502R probably null Het
Dido1 A T 2: 180,683,967 V476E probably benign Het
Dnah2 T C 11: 69,518,359 K398E probably benign Het
E130308A19Rik A G 4: 59,737,565 Y392C probably damaging Het
Esf1 T A 2: 140,168,389 D9V probably benign Het
Fam168a A G 7: 100,824,150 Q82R probably damaging Het
Fastkd3 C T 13: 68,590,218 Q32* probably null Het
Gm12394 A G 4: 42,793,065 S356P possibly damaging Het
Gm13084 A T 4: 143,812,764 M53K possibly damaging Het
Gm14496 T A 2: 181,991,227 M1K probably null Het
Gm6665 A G 18: 31,819,884 M79T probably benign Het
Gna15 A G 10: 81,509,344 L229P probably damaging Het
Herc1 A G 9: 66,497,250 T4451A probably damaging Het
Igf2bp1 A G 11: 95,975,296 V122A probably damaging Het
Ighv5-4 A T 12: 113,597,693 S36T probably damaging Het
Ints3 A G 3: 90,413,554 V186A probably benign Het
Jrk A G 15: 74,706,680 I252T possibly damaging Het
Kcnh5 T C 12: 75,087,591 S395G probably benign Het
Kcnt2 C T 1: 140,362,980 P103S probably damaging Het
Klra10 T C 6: 130,279,376 K105R probably benign Het
P4ha1 A T 10: 59,350,527 K276I possibly damaging Het
Pcyox1 A G 6: 86,388,928 S435P possibly damaging Het
R3hdm1 A T 1: 128,169,036 N103I probably damaging Het
Rnf213 T C 11: 119,411,513 V421A probably damaging Het
Rnpc3 A T 3: 113,609,056 probably null Het
Scaf11 A G 15: 96,420,454 S410P probably benign Het
Slc16a1 A G 3: 104,653,194 T272A probably benign Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Slitrk3 T C 3: 73,049,762 D559G probably damaging Het
Sntb2 G A 8: 106,981,225 G207D probably damaging Het
Spdye4a T C 5: 143,225,718 I30M possibly damaging Het
Thumpd1 A T 7: 119,717,009 V239E probably damaging Het
Tnfsf15 T C 4: 63,744,925 S54G probably benign Het
Tor1aip1 A G 1: 156,007,205 I299T probably damaging Het
Tpst2 C T 5: 112,308,218 R208C probably damaging Het
Tubgcp2 T C 7: 140,007,597 Y285C probably damaging Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Washc5 A G 15: 59,335,110 S1105P probably damaging Het
Other mutations in Acot7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Acot7 APN 4 152260896 missense probably benign 0.39
IGL01758:Acot7 APN 4 152217793 missense probably damaging 0.96
IGL01991:Acot7 APN 4 152223079 missense possibly damaging 0.84
R1329:Acot7 UTSW 4 152229784 nonsense probably null
R1605:Acot7 UTSW 4 152206828 missense possibly damaging 0.46
R1625:Acot7 UTSW 4 152186291 missense probably benign 0.01
R1739:Acot7 UTSW 4 152260912 missense probably damaging 1.00
R4169:Acot7 UTSW 4 152217793 missense probably damaging 0.96
R4473:Acot7 UTSW 4 152206856 missense probably damaging 1.00
R4857:Acot7 UTSW 4 152237754 missense possibly damaging 0.76
R4884:Acot7 UTSW 4 152186207 intron probably benign
R5000:Acot7 UTSW 4 152186363 missense probably benign 0.00
R6633:Acot7 UTSW 4 152178259 missense probably benign
R6938:Acot7 UTSW 4 152217894 critical splice donor site probably null
R7025:Acot7 UTSW 4 152178189 missense unknown
Predicted Primers PCR Primer
(F):5'- AGAACAATGCCTACCTGGAGG -3'
(R):5'- GACACTATGCCTACACAGGG -3'

Sequencing Primer
(F):5'- CTACCTGGAGGGAGTGGG -3'
(R):5'- GCCTACACAGGGCCCAAG -3'
Posted On2017-08-16