Incidental Mutation 'R6123:Pcyox1'
ID485828
Institutional Source Beutler Lab
Gene Symbol Pcyox1
Ensembl Gene ENSMUSG00000029998
Gene Nameprenylcysteine oxidase 1
Synonyms1200015P13Rik, Pcly, PCL1
MMRRC Submission 044270-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6123 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location86386006-86397154 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86388928 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 435 (S435P)
Ref Sequence ENSEMBL: ENSMUSP00000032065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032065] [ENSMUST00000153723] [ENSMUST00000204116]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032065
AA Change: S435P

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032065
Gene: ENSMUSG00000029998
AA Change: S435P

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:NAD_binding_8 39 106 8.2e-13 PFAM
Pfam:Amino_oxidase 44 346 7.1e-9 PFAM
Pfam:Prenylcys_lyase 128 501 8.1e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131500
SMART Domains Protein: ENSMUSP00000122602
Gene: ENSMUSG00000029998

DomainStartEndE-ValueType
Pfam:Prenylcys_lyase 1 73 6.1e-25 PFAM
Pfam:Prenylcys_lyase 69 197 7.1e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153723
SMART Domains Protein: ENSMUSP00000119449
Gene: ENSMUSG00000029998

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Prenylcys_lyase 59 181 5.5e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204116
SMART Domains Protein: ENSMUSP00000145474
Gene: ENSMUSG00000029998

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:NAD_binding_8 39 106 4.9e-12 PFAM
Pfam:Amino_oxidase 44 136 3.3e-7 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product (Tschantz et al., 1999 [PubMed 10585463]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and free of obvious pathology despite a striking accumulation of both farnesylcysteine and geranylgeranylcysteine in brain and liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T C 2: 23,230,122 Y235H possibly damaging Het
Acot7 A G 4: 152,199,945 E24G probably benign Het
Ankrd34b A G 13: 92,439,076 E272G probably damaging Het
Arhgef18 A T 8: 3,437,091 N270I probably damaging Het
AU040320 A G 4: 126,869,386 probably benign Het
BC022687 T C 12: 112,810,910 F153L probably damaging Het
Btnl10 C A 11: 58,920,304 S151Y probably damaging Het
Ccdc146 C A 5: 21,305,597 R504I possibly damaging Het
Ckmt1 C G 2: 121,363,579 R408G probably benign Het
Cyp2j6 A T 4: 96,518,029 *502R probably null Het
Dido1 A T 2: 180,683,967 V476E probably benign Het
Dnah2 T C 11: 69,518,359 K398E probably benign Het
E130308A19Rik A G 4: 59,737,565 Y392C probably damaging Het
Esf1 T A 2: 140,168,389 D9V probably benign Het
Fam168a A G 7: 100,824,150 Q82R probably damaging Het
Fastkd3 C T 13: 68,590,218 Q32* probably null Het
Gm12394 A G 4: 42,793,065 S356P possibly damaging Het
Gm13084 A T 4: 143,812,764 M53K possibly damaging Het
Gm14496 T A 2: 181,991,227 M1K probably null Het
Gm6665 A G 18: 31,819,884 M79T probably benign Het
Gna15 A G 10: 81,509,344 L229P probably damaging Het
Herc1 A G 9: 66,497,250 T4451A probably damaging Het
Igf2bp1 A G 11: 95,975,296 V122A probably damaging Het
Ighv5-4 A T 12: 113,597,693 S36T probably damaging Het
Ints3 A G 3: 90,413,554 V186A probably benign Het
Jrk A G 15: 74,706,680 I252T possibly damaging Het
Kcnh5 T C 12: 75,087,591 S395G probably benign Het
Kcnt2 C T 1: 140,362,980 P103S probably damaging Het
Klra10 T C 6: 130,279,376 K105R probably benign Het
P4ha1 A T 10: 59,350,527 K276I possibly damaging Het
R3hdm1 A T 1: 128,169,036 N103I probably damaging Het
Rnf213 T C 11: 119,411,513 V421A probably damaging Het
Rnpc3 A T 3: 113,609,056 probably null Het
Scaf11 A G 15: 96,420,454 S410P probably benign Het
Slc16a1 A G 3: 104,653,194 T272A probably benign Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Slitrk3 T C 3: 73,049,762 D559G probably damaging Het
Sntb2 G A 8: 106,981,225 G207D probably damaging Het
Spdye4a T C 5: 143,225,718 I30M possibly damaging Het
Thumpd1 A T 7: 119,717,009 V239E probably damaging Het
Tnfsf15 T C 4: 63,744,925 S54G probably benign Het
Tor1aip1 A G 1: 156,007,205 I299T probably damaging Het
Tpst2 C T 5: 112,308,218 R208C probably damaging Het
Tubgcp2 T C 7: 140,007,597 Y285C probably damaging Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Washc5 A G 15: 59,335,110 S1105P probably damaging Het
Other mutations in Pcyox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01722:Pcyox1 APN 6 86388753 missense probably damaging 1.00
IGL02008:Pcyox1 APN 6 86392268 missense probably benign 0.01
IGL02655:Pcyox1 APN 6 86389344 missense probably damaging 1.00
R0690:Pcyox1 UTSW 6 86394442 missense probably damaging 1.00
R4631:Pcyox1 UTSW 6 86389143 missense probably benign 0.00
R4631:Pcyox1 UTSW 6 86389230 missense possibly damaging 0.96
R4976:Pcyox1 UTSW 6 86388726 missense probably damaging 1.00
R5227:Pcyox1 UTSW 6 86391744 missense probably damaging 0.98
R5288:Pcyox1 UTSW 6 86392354 splice site probably null
R5408:Pcyox1 UTSW 6 86392298 missense probably damaging 1.00
R5862:Pcyox1 UTSW 6 86391674 critical splice donor site probably null
R6002:Pcyox1 UTSW 6 86392182 missense probably benign 0.02
R6290:Pcyox1 UTSW 6 86388899 missense probably benign 0.24
R6766:Pcyox1 UTSW 6 86394408 critical splice donor site probably null
R7047:Pcyox1 UTSW 6 86388909 missense probably damaging 1.00
R7066:Pcyox1 UTSW 6 86394496 missense probably damaging 1.00
R7139:Pcyox1 UTSW 6 86394537 missense possibly damaging 0.50
R7268:Pcyox1 UTSW 6 86391731 missense possibly damaging 0.69
R7445:Pcyox1 UTSW 6 86391679 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ATCAATCATGTCCTCATTGCCG -3'
(R):5'- ACCCAAGGATCAGTTTGGCC -3'

Sequencing Primer
(F):5'- CGTTCCAGCGGTGGTAG -3'
(R):5'- CAAGGATCAGTTTGGCCTCTCG -3'
Posted On2017-08-16