Incidental Mutation 'R6123:Slco3a1'
ID485830
Institutional Source Beutler Lab
Gene Symbol Slco3a1
Ensembl Gene ENSMUSG00000025790
Gene Namesolute carrier organic anion transporter family, member 3a1
SynonymsOATP-D, Slc21a11, 5830414C08Rik, MJAM, Anr1
MMRRC Submission 044270-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R6123 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location74275419-74554780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 74318506 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 489 (D489N)
Ref Sequence ENSEMBL: ENSMUSP00000103077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026897] [ENSMUST00000098371] [ENSMUST00000107453]
Predicted Effect probably benign
Transcript: ENSMUST00000026897
AA Change: D489N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000026897
Gene: ENSMUSG00000025790
AA Change: D489N

DomainStartEndE-ValueType
low complexity region 7 16 N/A INTRINSIC
Pfam:MFS_1 44 455 1.2e-27 PFAM
KAZAL 474 509 2.77e-1 SMART
low complexity region 574 594 N/A INTRINSIC
transmembrane domain 626 648 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098371
AA Change: D489N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000095973
Gene: ENSMUSG00000025790
AA Change: D489N

DomainStartEndE-ValueType
low complexity region 7 16 N/A INTRINSIC
Pfam:MFS_1 44 456 1.2e-27 PFAM
KAZAL 474 509 2.77e-1 SMART
low complexity region 574 594 N/A INTRINSIC
transmembrane domain 626 648 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107453
AA Change: D489N

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000103077
Gene: ENSMUSG00000025790
AA Change: D489N

DomainStartEndE-ValueType
low complexity region 7 16 N/A INTRINSIC
Pfam:MFS_1 45 456 2e-27 PFAM
KAZAL 474 509 2.77e-1 SMART
low complexity region 574 589 N/A INTRINSIC
Meta Mutation Damage Score 0.052 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T C 2: 23,230,122 Y235H possibly damaging Het
Acot7 A G 4: 152,199,945 E24G probably benign Het
Ankrd34b A G 13: 92,439,076 E272G probably damaging Het
Arhgef18 A T 8: 3,437,091 N270I probably damaging Het
AU040320 A G 4: 126,869,386 probably benign Het
BC022687 T C 12: 112,810,910 F153L probably damaging Het
Btnl10 C A 11: 58,920,304 S151Y probably damaging Het
Ccdc146 C A 5: 21,305,597 R504I possibly damaging Het
Ckmt1 C G 2: 121,363,579 R408G probably benign Het
Cyp2j6 A T 4: 96,518,029 *502R probably null Het
Dido1 A T 2: 180,683,967 V476E probably benign Het
Dnah2 T C 11: 69,518,359 K398E probably benign Het
E130308A19Rik A G 4: 59,737,565 Y392C probably damaging Het
Esf1 T A 2: 140,168,389 D9V probably benign Het
Fam168a A G 7: 100,824,150 Q82R probably damaging Het
Fastkd3 C T 13: 68,590,218 Q32* probably null Het
Gm12394 A G 4: 42,793,065 S356P possibly damaging Het
Gm13084 A T 4: 143,812,764 M53K possibly damaging Het
Gm14496 T A 2: 181,991,227 M1K probably null Het
Gm6665 A G 18: 31,819,884 M79T probably benign Het
Gna15 A G 10: 81,509,344 L229P probably damaging Het
Herc1 A G 9: 66,497,250 T4451A probably damaging Het
Igf2bp1 A G 11: 95,975,296 V122A probably damaging Het
Ighv5-4 A T 12: 113,597,693 S36T probably damaging Het
Ints3 A G 3: 90,413,554 V186A probably benign Het
Jrk A G 15: 74,706,680 I252T possibly damaging Het
Kcnh5 T C 12: 75,087,591 S395G probably benign Het
Kcnt2 C T 1: 140,362,980 P103S probably damaging Het
Klra10 T C 6: 130,279,376 K105R probably benign Het
P4ha1 A T 10: 59,350,527 K276I possibly damaging Het
Pcyox1 A G 6: 86,388,928 S435P possibly damaging Het
R3hdm1 A T 1: 128,169,036 N103I probably damaging Het
Rnf213 T C 11: 119,411,513 V421A probably damaging Het
Rnpc3 A T 3: 113,609,056 probably null Het
Scaf11 A G 15: 96,420,454 S410P probably benign Het
Slc16a1 A G 3: 104,653,194 T272A probably benign Het
Slitrk3 T C 3: 73,049,762 D559G probably damaging Het
Sntb2 G A 8: 106,981,225 G207D probably damaging Het
Spdye4a T C 5: 143,225,718 I30M possibly damaging Het
Thumpd1 A T 7: 119,717,009 V239E probably damaging Het
Tnfsf15 T C 4: 63,744,925 S54G probably benign Het
Tor1aip1 A G 1: 156,007,205 I299T probably damaging Het
Tpst2 C T 5: 112,308,218 R208C probably damaging Het
Tubgcp2 T C 7: 140,007,597 Y285C probably damaging Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Washc5 A G 15: 59,335,110 S1105P probably damaging Het
Other mutations in Slco3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Slco3a1 APN 7 74504183 missense probably damaging 1.00
IGL01124:Slco3a1 APN 7 74284547 missense probably damaging 1.00
IGL01583:Slco3a1 APN 7 74284450 missense probably benign 0.01
IGL01929:Slco3a1 APN 7 74318605 splice site probably benign
IGL01991:Slco3a1 APN 7 74284396 missense possibly damaging 0.84
IGL02380:Slco3a1 APN 7 74554490 missense probably damaging 1.00
IGL03269:Slco3a1 APN 7 74318532 missense possibly damaging 0.58
R0052:Slco3a1 UTSW 7 74504326 missense probably benign 0.00
R0052:Slco3a1 UTSW 7 74504326 missense probably benign 0.00
R0317:Slco3a1 UTSW 7 74504426 missense probably damaging 1.00
R0545:Slco3a1 UTSW 7 74320553 nonsense probably null
R0613:Slco3a1 UTSW 7 74346634 unclassified probably benign
R1488:Slco3a1 UTSW 7 74346701 missense possibly damaging 0.94
R1506:Slco3a1 UTSW 7 74359935 intron probably null
R1571:Slco3a1 UTSW 7 74504380 missense possibly damaging 0.92
R1912:Slco3a1 UTSW 7 74504611 missense probably damaging 1.00
R2011:Slco3a1 UTSW 7 74346671 missense probably benign 0.08
R2382:Slco3a1 UTSW 7 74346776 missense probably benign 0.00
R3735:Slco3a1 UTSW 7 74504497 missense probably damaging 1.00
R3894:Slco3a1 UTSW 7 74284613 missense probably damaging 1.00
R4151:Slco3a1 UTSW 7 74359838 missense probably damaging 1.00
R4175:Slco3a1 UTSW 7 74318554 missense probably damaging 0.97
R4303:Slco3a1 UTSW 7 74554528 missense probably benign 0.03
R4462:Slco3a1 UTSW 7 74554563 missense probably benign 0.18
R4702:Slco3a1 UTSW 7 74320567 missense probably damaging 0.98
R4896:Slco3a1 UTSW 7 74320556 missense probably null 1.00
R5419:Slco3a1 UTSW 7 74284615 missense possibly damaging 0.77
R5561:Slco3a1 UTSW 7 74318499 missense possibly damaging 0.67
R5597:Slco3a1 UTSW 7 74284462 missense probably benign 0.31
R5698:Slco3a1 UTSW 7 74346818 missense probably damaging 1.00
R6086:Slco3a1 UTSW 7 74318590 missense possibly damaging 0.64
R6117:Slco3a1 UTSW 7 74318506 missense probably benign 0.02
R6118:Slco3a1 UTSW 7 74318506 missense probably benign 0.02
R6124:Slco3a1 UTSW 7 74318506 missense probably benign 0.02
R6125:Slco3a1 UTSW 7 74318506 missense probably benign 0.02
R7147:Slco3a1 UTSW 7 74504294 missense probably damaging 1.00
R7332:Slco3a1 UTSW 7 74318484 missense possibly damaging 0.95
R7335:Slco3a1 UTSW 7 74284342 missense probably damaging 0.99
X0017:Slco3a1 UTSW 7 74284360 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTTGACTCAGCAAAGGCCTG -3'
(R):5'- AGCACTTGAAGGTCAGCCAG -3'

Sequencing Primer
(F):5'- GTCCTGTTGTCCTCCTGATGG -3'
(R):5'- CACTTGAAGGTCAGCCAGGAATAAG -3'
Posted On2017-08-16