Incidental Mutation 'R6123:Sntb2'
ID485835
Institutional Source Beutler Lab
Gene Symbol Sntb2
Ensembl Gene ENSMUSG00000041308
Gene Namesyntrophin, basic 2
SynonymsSnt2
MMRRC Submission 044270-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.681) question?
Stock #R6123 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location106935750-107019714 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106981225 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 207 (G207D)
Ref Sequence ENSEMBL: ENSMUSP00000148684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047425] [ENSMUST00000212524]
Predicted Effect probably damaging
Transcript: ENSMUST00000047425
AA Change: G207D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037324
Gene: ENSMUSG00000041308
AA Change: G207D

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
low complexity region 39 50 N/A INTRINSIC
low complexity region 62 92 N/A INTRINSIC
low complexity region 93 99 N/A INTRINSIC
PDZ 104 178 1.48e-17 SMART
PH 144 282 3.52e0 SMART
PH 306 419 4.07e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212298
Predicted Effect probably damaging
Transcript: ENSMUST00000212524
AA Change: G207D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dystrophin is a large, rod-like cytoskeletal protein found at the inner surface of muscle fibers. Dystrophin is missing in Duchenne Muscular Dystrophy patients and is present in reduced amounts in Becker Muscular Dystrophy patients. The protein encoded by this gene is a peripheral membrane protein found associated with dystrophin and dystrophin-related proteins. This gene is a member of the syntrophin gene family, which contains at least two other structurally-related genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have no overt phenotype. They are fertile and motile with no signs of muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T C 2: 23,230,122 Y235H possibly damaging Het
Acot7 A G 4: 152,199,945 E24G probably benign Het
Ankrd34b A G 13: 92,439,076 E272G probably damaging Het
Arhgef18 A T 8: 3,437,091 N270I probably damaging Het
AU040320 A G 4: 126,869,386 probably benign Het
BC022687 T C 12: 112,810,910 F153L probably damaging Het
Btnl10 C A 11: 58,920,304 S151Y probably damaging Het
Ccdc146 C A 5: 21,305,597 R504I possibly damaging Het
Ckmt1 C G 2: 121,363,579 R408G probably benign Het
Cyp2j6 A T 4: 96,518,029 *502R probably null Het
Dido1 A T 2: 180,683,967 V476E probably benign Het
Dnah2 T C 11: 69,518,359 K398E probably benign Het
E130308A19Rik A G 4: 59,737,565 Y392C probably damaging Het
Esf1 T A 2: 140,168,389 D9V probably benign Het
Fam168a A G 7: 100,824,150 Q82R probably damaging Het
Fastkd3 C T 13: 68,590,218 Q32* probably null Het
Gm12394 A G 4: 42,793,065 S356P possibly damaging Het
Gm13084 A T 4: 143,812,764 M53K possibly damaging Het
Gm14496 T A 2: 181,991,227 M1K probably null Het
Gm6665 A G 18: 31,819,884 M79T probably benign Het
Gna15 A G 10: 81,509,344 L229P probably damaging Het
Herc1 A G 9: 66,497,250 T4451A probably damaging Het
Igf2bp1 A G 11: 95,975,296 V122A probably damaging Het
Ighv5-4 A T 12: 113,597,693 S36T probably damaging Het
Ints3 A G 3: 90,413,554 V186A probably benign Het
Jrk A G 15: 74,706,680 I252T possibly damaging Het
Kcnh5 T C 12: 75,087,591 S395G probably benign Het
Kcnt2 C T 1: 140,362,980 P103S probably damaging Het
Klra10 T C 6: 130,279,376 K105R probably benign Het
P4ha1 A T 10: 59,350,527 K276I possibly damaging Het
Pcyox1 A G 6: 86,388,928 S435P possibly damaging Het
R3hdm1 A T 1: 128,169,036 N103I probably damaging Het
Rnf213 T C 11: 119,411,513 V421A probably damaging Het
Rnpc3 A T 3: 113,609,056 probably null Het
Scaf11 A G 15: 96,420,454 S410P probably benign Het
Slc16a1 A G 3: 104,653,194 T272A probably benign Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Slitrk3 T C 3: 73,049,762 D559G probably damaging Het
Spdye4a T C 5: 143,225,718 I30M possibly damaging Het
Thumpd1 A T 7: 119,717,009 V239E probably damaging Het
Tnfsf15 T C 4: 63,744,925 S54G probably benign Het
Tor1aip1 A G 1: 156,007,205 I299T probably damaging Het
Tpst2 C T 5: 112,308,218 R208C probably damaging Het
Tubgcp2 T C 7: 140,007,597 Y285C probably damaging Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Washc5 A G 15: 59,335,110 S1105P probably damaging Het
Other mutations in Sntb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0226:Sntb2 UTSW 8 107001583 missense probably damaging 1.00
R0345:Sntb2 UTSW 8 107001538 missense probably damaging 1.00
R0766:Sntb2 UTSW 8 107001577 missense probably damaging 1.00
R1027:Sntb2 UTSW 8 106991571 missense probably benign 0.28
R1312:Sntb2 UTSW 8 107001577 missense probably damaging 1.00
R1514:Sntb2 UTSW 8 106991532 missense probably damaging 1.00
R1942:Sntb2 UTSW 8 107011352 missense probably damaging 0.98
R2937:Sntb2 UTSW 8 106936097 missense probably benign 0.06
R3968:Sntb2 UTSW 8 106997140 nonsense probably null
R4455:Sntb2 UTSW 8 106991607 critical splice donor site probably null
R4458:Sntb2 UTSW 8 106991607 critical splice donor site probably null
R4526:Sntb2 UTSW 8 107009963 missense probably damaging 0.99
R7378:Sntb2 UTSW 8 106981312 missense probably damaging 1.00
R7458:Sntb2 UTSW 8 106936298 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GGGTCAAGCTCAAGGGTTTG -3'
(R):5'- GGGCTCCAAAATTAAAGACAGATCTC -3'

Sequencing Primer
(F):5'- TCATTCTATAGAACAGGCTGGCC -3'
(R):5'- CTGATCTCAGAACAGGAGGAGGC -3'
Posted On2017-08-16