Incidental Mutation 'R6123:Btnl10'
ID485839
Institutional Source Beutler Lab
Gene Symbol Btnl10
Ensembl Gene ENSMUSG00000020490
Gene Namebutyrophilin-like 10
SynonymsButr1, BUTR-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R6123 (G1)
Quality Score212.009
Status Not validated
Chromosome11
Chromosomal Location58917908-58927158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 58920304 bp
ZygosityHeterozygous
Amino Acid Change Serine to Tyrosine at position 151 (S151Y)
Ref Sequence ENSEMBL: ENSMUSP00000124234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020792] [ENSMUST00000069941] [ENSMUST00000108818] [ENSMUST00000142499]
Predicted Effect probably damaging
Transcript: ENSMUST00000020792
AA Change: S151Y

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020792
Gene: ENSMUSG00000020490
AA Change: S151Y

DomainStartEndE-ValueType
IGv 49 130 2.62e-7 SMART
Pfam:C2-set_2 150 233 3.6e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000069941
AA Change: S151Y

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000063279
Gene: ENSMUSG00000020490
AA Change: S151Y

DomainStartEndE-ValueType
IGv 49 130 2.62e-7 SMART
Pfam:C2-set_2 150 233 5.5e-7 PFAM
PRY 300 352 1.11e-11 SMART
SPRY 353 474 6.55e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108818
AA Change: S151Y

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104446
Gene: ENSMUSG00000020490
AA Change: S151Y

DomainStartEndE-ValueType
IGv 49 130 2.62e-7 SMART
Pfam:C2-set_2 150 233 3.6e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000142499
AA Change: S151Y

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124234
Gene: ENSMUSG00000020490
AA Change: S151Y

DomainStartEndE-ValueType
IGv 49 130 2.62e-7 SMART
Pfam:C2-set_2 151 233 1e-8 PFAM
PRY 300 352 1.11e-11 SMART
SPRY 353 474 6.55e-24 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T C 2: 23,230,122 Y235H possibly damaging Het
Acot7 A G 4: 152,199,945 E24G probably benign Het
Ankrd34b A G 13: 92,439,076 E272G probably damaging Het
Arhgef18 A T 8: 3,437,091 N270I probably damaging Het
AU040320 A G 4: 126,869,386 probably benign Het
BC022687 T C 12: 112,810,910 F153L probably damaging Het
Ccdc146 C A 5: 21,305,597 R504I possibly damaging Het
Ckmt1 C G 2: 121,363,579 R408G probably benign Het
Cyp2j6 A T 4: 96,518,029 *502R probably null Het
Dido1 A T 2: 180,683,967 V476E probably benign Het
Dnah2 T C 11: 69,518,359 K398E probably benign Het
E130308A19Rik A G 4: 59,737,565 Y392C probably damaging Het
Esf1 T A 2: 140,168,389 D9V probably benign Het
Fam168a A G 7: 100,824,150 Q82R probably damaging Het
Fastkd3 C T 13: 68,590,218 Q32* probably null Het
Gm12394 A G 4: 42,793,065 S356P possibly damaging Het
Gm13084 A T 4: 143,812,764 M53K possibly damaging Het
Gm14496 T A 2: 181,991,227 M1K probably null Het
Gm6665 A G 18: 31,819,884 M79T probably benign Het
Gna15 A G 10: 81,509,344 L229P probably damaging Het
Herc1 A G 9: 66,497,250 T4451A probably damaging Het
Igf2bp1 A G 11: 95,975,296 V122A probably damaging Het
Ighv5-4 A T 12: 113,597,693 S36T probably damaging Het
Ints3 A G 3: 90,413,554 V186A probably benign Het
Jrk A G 15: 74,706,680 I252T possibly damaging Het
Kcnh5 T C 12: 75,087,591 S395G probably benign Het
Kcnt2 C T 1: 140,362,980 P103S probably damaging Het
Klra10 T C 6: 130,279,376 K105R probably benign Het
P4ha1 A T 10: 59,350,527 K276I possibly damaging Het
Pcyox1 A G 6: 86,388,928 S435P possibly damaging Het
R3hdm1 A T 1: 128,169,036 N103I probably damaging Het
Rnf213 T C 11: 119,411,513 V421A probably damaging Het
Rnpc3 A T 3: 113,609,056 probably null Het
Scaf11 A G 15: 96,420,454 S410P probably benign Het
Slc16a1 A G 3: 104,653,194 T272A probably benign Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Slitrk3 T C 3: 73,049,762 D559G probably damaging Het
Sntb2 G A 8: 106,981,225 G207D probably damaging Het
Spdye4a T C 5: 143,225,718 I30M possibly damaging Het
Thumpd1 A T 7: 119,717,009 V239E probably damaging Het
Tnfsf15 T C 4: 63,744,925 S54G probably benign Het
Tor1aip1 A G 1: 156,007,205 I299T probably damaging Het
Tpst2 C T 5: 112,308,218 R208C probably damaging Het
Tubgcp2 T C 7: 140,007,597 Y285C probably damaging Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Washc5 A G 15: 59,335,110 S1105P probably damaging Het
Other mutations in Btnl10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02033:Btnl10 APN 11 58919315 missense probably damaging 0.98
IGL03368:Btnl10 APN 11 58919386 missense possibly damaging 0.61
FR4304:Btnl10 UTSW 11 58923930 small insertion probably benign
FR4449:Btnl10 UTSW 11 58923928 small insertion probably benign
FR4589:Btnl10 UTSW 11 58923929 small insertion probably benign
FR4737:Btnl10 UTSW 11 58923931 small insertion probably benign
FR4976:Btnl10 UTSW 11 58923929 small insertion probably benign
R0420:Btnl10 UTSW 11 58923451 missense probably damaging 1.00
R1875:Btnl10 UTSW 11 58923760 missense probably damaging 0.97
R1908:Btnl10 UTSW 11 58920541 missense possibly damaging 0.74
R3176:Btnl10 UTSW 11 58922390 missense probably benign 0.00
R3177:Btnl10 UTSW 11 58922390 missense probably benign 0.00
R3276:Btnl10 UTSW 11 58922390 missense probably benign 0.00
R3277:Btnl10 UTSW 11 58922390 missense probably benign 0.00
R4600:Btnl10 UTSW 11 58923600 missense probably benign 0.01
R4611:Btnl10 UTSW 11 58920357 missense probably damaging 1.00
R5447:Btnl10 UTSW 11 58922318 missense probably benign 0.13
R5484:Btnl10 UTSW 11 58923825 missense probably damaging 0.98
R5787:Btnl10 UTSW 11 58920343 missense probably damaging 1.00
R5824:Btnl10 UTSW 11 58923440 missense probably benign 0.05
R5859:Btnl10 UTSW 11 58922312 missense probably benign 0.10
R6109:Btnl10 UTSW 11 58920304 missense probably damaging 0.98
R6318:Btnl10 UTSW 11 58926865 utr 3 prime probably benign
X0064:Btnl10 UTSW 11 58923610 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTCAACCGTTTTATTTGGGATG -3'
(R):5'- GCAGGTAAGTCTCTGTCACC -3'

Sequencing Primer
(F):5'- GGGATGAAGGTATTGCATTAGTAATG -3'
(R):5'- CGTATCCTGGGGAGTCACAATG -3'
Posted On2017-08-16