Mutagenetix > Incidental Mutation

Incidental Mutation 'R6124:Sis'

485857

Institutional Source

Beutler Lab

Gene Symbol

Sis

Ensembl Gene

ENSMUSG00000027790

Gene Name

sucrase isomaltase

Synonyms

2010204N08Rik, Si-s, sucrase-isomaltase

MMRRC Submission

044271-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6124 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

72795890-72875196 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 72860544 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 261 (N261S)

Ref Sequence

ENSEMBL: ENSMUSP00000129116 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094190] [ENSMUST00000167334]

AlphaFold

F8VQM5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000094190
AA Change: N261S

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000091742
Gene: ENSMUSG00000027790
AA Change: N261S

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
PD	51	103	1.92e-12	SMART
Pfam:NtCtMGAM_N	115	224	1.2e-35	PFAM
Pfam:Gal_mutarotas_2	225	294	4.8e-9	PFAM
Pfam:Glyco_hydro_31	314	787	2.1e-142	PFAM
PD	917	972	6.69e-12	SMART
Pfam:NtCtMGAM_N	985	1098	6e-33	PFAM
Blast:ANK	1138	1168	1e-5	BLAST
Pfam:Glyco_hydro_31	1186	1682	8.4e-137	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167334
AA Change: N261S

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000129116
Gene: ENSMUSG00000027790
AA Change: N261S

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
PD	51	103	1.92e-12	SMART
Pfam:NtCtMGAM_N	115	224	1.2e-35	PFAM
Pfam:Gal_mutarotas_2	225	294	4.8e-9	PFAM
Pfam:Glyco_hydro_31	314	787	2.1e-142	PFAM
PD	917	972	6.69e-12	SMART
Pfam:NtCtMGAM_N	985	1098	6e-33	PFAM
Blast:ANK	1138	1168	1e-5	BLAST
Pfam:Glyco_hydro_31	1186	1682	8.4e-137	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191870

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sucrase-isomaltase enzyme that is expressed in the intestinal brush border. The encoded protein is synthesized as a precursor protein that is cleaved by pancreatic proteases into two enzymatic subunits sucrase and isomaltase. These two subunits heterodimerize to form the sucrose-isomaltase complex. This complex is essential for the digestion of dietary carbohydrates including starch, sucrose and isomaltose. Mutations in this gene are the cause of congenital sucrase-isomaltase deficiency.[provided by RefSeq, Apr 2010]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900026A02Rik	T	C	5: 113,331,622 (GRCm39)	N864S	probably benign	Het
Ank2	C	T	3: 127,041,800 (GRCm39)	V35M	probably benign	Het
Apc2	T	C	10: 80,142,185 (GRCm39)	M368T	probably damaging	Het
Atp8b3	G	A	10: 80,365,515 (GRCm39)	T413M	probably damaging	Het
Cxcr4	A	G	1: 128,517,397 (GRCm39)	L86P	probably damaging	Het
Cyfip1	A	G	7: 55,547,691 (GRCm39)	Y598C	probably benign	Het
Epg5	A	G	18: 78,073,260 (GRCm39)	N2428D	probably benign	Het
Fastkd3	C	T	13: 68,738,337 (GRCm39)	Q32*	probably null	Het
Fkbpl	G	A	17: 34,864,303 (GRCm39)	A24T	probably benign	Het
Gm5422	A	G	10: 31,125,396 (GRCm39)		noncoding transcript	Het
Gm9913	T	A	2: 125,348,393 (GRCm39)		probably benign	Het
Hgfac	A	G	5: 35,201,728 (GRCm39)	N287S	probably benign	Het
Hook3	A	T	8: 26,549,300 (GRCm39)	N181K	probably benign	Het
Hormad1	A	G	3: 95,483,613 (GRCm39)	T142A	probably benign	Het
Klrh1	A	T	6: 129,745,098 (GRCm39)	F166Y	probably benign	Het
Kplce	G	T	3: 92,776,365 (GRCm39)	P106Q	probably damaging	Het
Lonrf1	T	A	8: 36,696,354 (GRCm39)	N565I	probably damaging	Het
Mast1	A	G	8: 85,651,936 (GRCm39)	S349P	probably benign	Het
Mcee	T	A	7: 64,050,023 (GRCm39)	N51K	probably damaging	Het
Mfsd6	A	C	1: 52,747,411 (GRCm39)	F485V	probably damaging	Het
Mptx2	G	A	1: 173,102,414 (GRCm39)	L92F	probably benign	Het
Nlrp6	T	A	7: 140,503,160 (GRCm39)	V422E	probably damaging	Het
Nrap	A	G	19: 56,374,458 (GRCm39)	S23P	probably damaging	Het
Nsd2	T	A	5: 34,000,610 (GRCm39)	H42Q	probably benign	Het
Obscn	A	T	11: 58,969,870 (GRCm39)	S91T	probably benign	Het
Or10ak13	C	A	4: 118,639,392 (GRCm39)	C130F	probably damaging	Het
Or10j2	T	A	1: 173,097,846 (GRCm39)	Y35N	probably damaging	Het
Or13a20	A	T	7: 140,232,507 (GRCm39)	D205V	probably damaging	Het
Or5p72	A	T	7: 108,022,725 (GRCm39)		probably null	Het
Or6c215	G	A	10: 129,637,689 (GRCm39)	A235V	probably damaging	Het
Or6c215	C	A	10: 129,637,690 (GRCm39)	A235S	probably damaging	Het
Or6d15	T	C	6: 116,559,446 (GRCm39)	I154V	probably benign	Het
Papss2	T	A	19: 32,614,528 (GRCm39)	N81K	probably damaging	Het
Plekhn1	A	G	4: 156,309,696 (GRCm39)	I147T	possibly damaging	Het
Ptgfrn	C	T	3: 100,980,405 (GRCm39)	E312K	probably damaging	Het
Serpinb1b	T	C	13: 33,277,796 (GRCm39)	V343A	probably benign	Het
Slc41a2	T	C	10: 83,133,116 (GRCm39)	N310S	probably damaging	Het
Slco3a1	C	T	7: 73,968,254 (GRCm39)	D489N	probably benign	Het
Snrnp48	T	A	13: 38,400,439 (GRCm39)	I182N	possibly damaging	Het
Tppp2	A	T	14: 52,156,937 (GRCm39)	T105S	probably benign	Het
Vav3	C	T	3: 109,571,681 (GRCm39)	T201M	probably damaging	Het
Vmn1r19	A	C	6: 57,381,602 (GRCm39)	M52L	probably benign	Het
Vmn2r94	T	A	17: 18,464,321 (GRCm39)	R656S	probably benign	Het

Other mutations in Sis

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00582:Sis	APN	3	72,853,969 (GRCm39)	missense	probably benign
IGL00715:Sis	APN	3	72,841,457 (GRCm39)	missense	probably damaging	1.00
IGL00721:Sis	APN	3	72,850,912 (GRCm39)	missense	probably damaging	1.00
IGL00766:Sis	APN	3	72,814,570 (GRCm39)	splice site	probably benign
IGL00783:Sis	APN	3	72,853,965 (GRCm39)	missense	probably benign
IGL00805:Sis	APN	3	72,841,532 (GRCm39)	missense	probably benign	0.05
IGL00932:Sis	APN	3	72,848,289 (GRCm39)	splice site	probably benign
IGL01020:Sis	APN	3	72,874,171 (GRCm39)	missense	probably damaging	1.00
IGL01024:Sis	APN	3	72,819,209 (GRCm39)	missense	probably damaging	1.00
IGL01286:Sis	APN	3	72,848,358 (GRCm39)	missense	probably damaging	1.00
IGL01457:Sis	APN	3	72,868,354 (GRCm39)	missense	probably benign
IGL01514:Sis	APN	3	72,843,253 (GRCm39)	splice site	probably benign
IGL01986:Sis	APN	3	72,852,545 (GRCm39)	missense	probably damaging	1.00
IGL02110:Sis	APN	3	72,836,032 (GRCm39)	nonsense	probably null
IGL02132:Sis	APN	3	72,854,804 (GRCm39)	missense	probably benign	0.00
IGL02152:Sis	APN	3	72,796,319 (GRCm39)	utr 3 prime	probably benign
IGL02200:Sis	APN	3	72,850,937 (GRCm39)	missense	probably damaging	0.99
IGL02244:Sis	APN	3	72,863,523 (GRCm39)	missense	probably benign	0.19
IGL02307:Sis	APN	3	72,819,167 (GRCm39)	splice site	probably benign
IGL02374:Sis	APN	3	72,832,789 (GRCm39)	missense	probably benign	0.03
IGL02437:Sis	APN	3	72,826,947 (GRCm39)	critical splice acceptor site	probably null
IGL02571:Sis	APN	3	72,863,637 (GRCm39)	splice site	probably benign
IGL02601:Sis	APN	3	72,820,543 (GRCm39)	missense	probably benign	0.44
IGL03063:Sis	APN	3	72,835,630 (GRCm39)	missense	probably benign
IGL03382:Sis	APN	3	72,836,052 (GRCm39)	missense	probably benign	0.00
IGL03397:Sis	APN	3	72,843,212 (GRCm39)	missense	probably benign	0.44
PIT1430001:Sis	UTSW	3	72,830,162 (GRCm39)	missense	probably damaging	0.97
R0013:Sis	UTSW	3	72,817,809 (GRCm39)	missense	possibly damaging	0.65
R0013:Sis	UTSW	3	72,817,809 (GRCm39)	missense	possibly damaging	0.65
R0046:Sis	UTSW	3	72,839,427 (GRCm39)	missense	probably benign	0.01
R0094:Sis	UTSW	3	72,828,770 (GRCm39)	missense	probably damaging	1.00
R0096:Sis	UTSW	3	72,835,600 (GRCm39)	missense	probably damaging	1.00
R0505:Sis	UTSW	3	72,867,629 (GRCm39)	missense	probably benign	0.29
R0544:Sis	UTSW	3	72,858,975 (GRCm39)	missense	probably damaging	1.00
R0551:Sis	UTSW	3	72,832,740 (GRCm39)	missense	possibly damaging	0.79
R0617:Sis	UTSW	3	72,872,938 (GRCm39)	missense	probably damaging	1.00
R0698:Sis	UTSW	3	72,817,831 (GRCm39)	missense	probably damaging	1.00
R0701:Sis	UTSW	3	72,848,378 (GRCm39)	missense	probably damaging	1.00
R0704:Sis	UTSW	3	72,857,155 (GRCm39)	missense	possibly damaging	0.63
R0706:Sis	UTSW	3	72,859,864 (GRCm39)	missense	probably damaging	1.00
R0710:Sis	UTSW	3	72,859,864 (GRCm39)	missense	probably damaging	1.00
R0752:Sis	UTSW	3	72,859,864 (GRCm39)	missense	probably damaging	1.00
R0753:Sis	UTSW	3	72,859,864 (GRCm39)	missense	probably damaging	1.00
R0754:Sis	UTSW	3	72,859,864 (GRCm39)	missense	probably damaging	1.00
R0767:Sis	UTSW	3	72,859,864 (GRCm39)	missense	probably damaging	1.00
R0769:Sis	UTSW	3	72,859,864 (GRCm39)	missense	probably damaging	1.00
R0772:Sis	UTSW	3	72,859,864 (GRCm39)	missense	probably damaging	1.00
R0774:Sis	UTSW	3	72,859,864 (GRCm39)	missense	probably damaging	1.00
R0776:Sis	UTSW	3	72,859,864 (GRCm39)	missense	probably damaging	1.00
R0818:Sis	UTSW	3	72,859,864 (GRCm39)	missense	probably damaging	1.00
R0819:Sis	UTSW	3	72,859,864 (GRCm39)	missense	probably damaging	1.00
R0885:Sis	UTSW	3	72,819,282 (GRCm39)	nonsense	probably null
R1076:Sis	UTSW	3	72,841,431 (GRCm39)	missense	probably damaging	0.97
R1140:Sis	UTSW	3	72,858,949 (GRCm39)	missense	probably damaging	0.98
R1175:Sis	UTSW	3	72,865,437 (GRCm39)	splice site	probably benign
R1301:Sis	UTSW	3	72,853,915 (GRCm39)	missense	possibly damaging	0.76
R1437:Sis	UTSW	3	72,841,475 (GRCm39)	missense	probably damaging	1.00
R1466:Sis	UTSW	3	72,839,393 (GRCm39)	missense	possibly damaging	0.60
R1466:Sis	UTSW	3	72,839,393 (GRCm39)	missense	possibly damaging	0.60
R1472:Sis	UTSW	3	72,796,360 (GRCm39)	missense	probably benign	0.12
R1584:Sis	UTSW	3	72,839,393 (GRCm39)	missense	possibly damaging	0.60
R1707:Sis	UTSW	3	72,816,420 (GRCm39)	splice site	probably benign
R1715:Sis	UTSW	3	72,796,343 (GRCm39)	missense	possibly damaging	0.47
R1719:Sis	UTSW	3	72,872,937 (GRCm39)	missense	probably damaging	1.00
R1728:Sis	UTSW	3	72,872,978 (GRCm39)	nonsense	probably null
R1784:Sis	UTSW	3	72,872,978 (GRCm39)	nonsense	probably null
R1820:Sis	UTSW	3	72,828,475 (GRCm39)	missense	probably damaging	1.00
R1972:Sis	UTSW	3	72,828,337 (GRCm39)	missense	probably damaging	1.00
R1973:Sis	UTSW	3	72,828,337 (GRCm39)	missense	probably damaging	1.00
R2054:Sis	UTSW	3	72,820,570 (GRCm39)	missense	probably benign	0.01
R2233:Sis	UTSW	3	72,820,527 (GRCm39)	missense	probably benign	0.03
R2235:Sis	UTSW	3	72,820,527 (GRCm39)	missense	probably benign	0.03
R2276:Sis	UTSW	3	72,821,934 (GRCm39)	nonsense	probably null
R2435:Sis	UTSW	3	72,819,237 (GRCm39)	missense	probably benign	0.01
R2885:Sis	UTSW	3	72,816,506 (GRCm39)	missense	probably benign	0.01
R2966:Sis	UTSW	3	72,796,343 (GRCm39)	missense	probably benign	0.30
R3708:Sis	UTSW	3	72,850,856 (GRCm39)	missense	probably benign	0.02
R3790:Sis	UTSW	3	72,828,747 (GRCm39)	missense	probably damaging	1.00
R3807:Sis	UTSW	3	72,832,929 (GRCm39)	missense	probably benign	0.01
R3858:Sis	UTSW	3	72,835,985 (GRCm39)	missense	probably damaging	0.99
R3974:Sis	UTSW	3	72,850,968 (GRCm39)	missense	probably damaging	0.96
R3975:Sis	UTSW	3	72,850,968 (GRCm39)	missense	probably damaging	0.96
R4037:Sis	UTSW	3	72,835,935 (GRCm39)	missense	probably benign
R4080:Sis	UTSW	3	72,828,517 (GRCm39)	missense	probably damaging	1.00
R4204:Sis	UTSW	3	72,868,415 (GRCm39)	missense	probably benign
R4394:Sis	UTSW	3	72,863,482 (GRCm39)	missense	probably damaging	1.00
R4470:Sis	UTSW	3	72,835,492 (GRCm39)	splice site	probably null
R4573:Sis	UTSW	3	72,835,570 (GRCm39)	missense	possibly damaging	0.94
R4868:Sis	UTSW	3	72,850,881 (GRCm39)	missense	probably benign	0.09
R5023:Sis	UTSW	3	72,841,455 (GRCm39)	missense	probably benign	0.05
R5264:Sis	UTSW	3	72,857,089 (GRCm39)	missense	probably damaging	0.98
R5414:Sis	UTSW	3	72,859,826 (GRCm39)	missense	probably benign
R5462:Sis	UTSW	3	72,857,171 (GRCm39)	missense	probably damaging	0.96
R5523:Sis	UTSW	3	72,798,754 (GRCm39)	missense	probably benign	0.00
R5584:Sis	UTSW	3	72,817,748 (GRCm39)	missense	probably damaging	1.00
R5587:Sis	UTSW	3	72,821,909 (GRCm39)	missense	possibly damaging	0.94
R5725:Sis	UTSW	3	72,872,931 (GRCm39)	missense	probably damaging	1.00
R5769:Sis	UTSW	3	72,835,568 (GRCm39)	missense	probably damaging	0.98
R5790:Sis	UTSW	3	72,835,507 (GRCm39)	missense	probably benign
R5864:Sis	UTSW	3	72,857,151 (GRCm39)	missense	probably damaging	1.00
R5902:Sis	UTSW	3	72,867,589 (GRCm39)	critical splice donor site	probably null
R5925:Sis	UTSW	3	72,828,713 (GRCm39)	splice site	probably null
R6018:Sis	UTSW	3	72,820,525 (GRCm39)	missense	possibly damaging	0.95
R6029:Sis	UTSW	3	72,835,641 (GRCm39)	missense	probably benign	0.30
R6171:Sis	UTSW	3	72,868,360 (GRCm39)	missense	possibly damaging	0.75
R6182:Sis	UTSW	3	72,811,626 (GRCm39)	missense	probably benign	0.05
R6295:Sis	UTSW	3	72,874,103 (GRCm39)	missense	probably damaging	0.99
R6416:Sis	UTSW	3	72,819,187 (GRCm39)	missense	probably damaging	1.00
R6431:Sis	UTSW	3	72,865,507 (GRCm39)	missense	probably benign	0.00
R6472:Sis	UTSW	3	72,846,067 (GRCm39)	nonsense	probably null
R6517:Sis	UTSW	3	72,814,475 (GRCm39)	missense	probably damaging	1.00
R6701:Sis	UTSW	3	72,856,860 (GRCm39)	missense	probably damaging	1.00
R6796:Sis	UTSW	3	72,872,951 (GRCm39)	missense	probably benign	0.06
R6853:Sis	UTSW	3	72,798,759 (GRCm39)	missense	possibly damaging	0.93
R6906:Sis	UTSW	3	72,826,818 (GRCm39)	missense	probably damaging	1.00
R7058:Sis	UTSW	3	72,810,940 (GRCm39)	missense	probably damaging	0.98
R7357:Sis	UTSW	3	72,832,404 (GRCm39)	missense	probably damaging	1.00
R7381:Sis	UTSW	3	72,820,625 (GRCm39)	splice site	probably null
R7439:Sis	UTSW	3	72,816,374 (GRCm39)	missense	possibly damaging	0.81
R7742:Sis	UTSW	3	72,832,431 (GRCm39)	missense	probably benign	0.19
R7813:Sis	UTSW	3	72,832,801 (GRCm39)	missense	probably benign	0.01
R7883:Sis	UTSW	3	72,828,329 (GRCm39)	missense	possibly damaging	0.78
R7899:Sis	UTSW	3	72,844,584 (GRCm39)	missense	probably damaging	1.00
R7915:Sis	UTSW	3	72,828,471 (GRCm39)	missense	probably damaging	0.99
R7985:Sis	UTSW	3	72,844,294 (GRCm39)	splice site	probably null
R8020:Sis	UTSW	3	72,816,298 (GRCm39)	critical splice donor site	probably null
R8023:Sis	UTSW	3	72,859,813 (GRCm39)	missense	probably damaging	0.97
R8029:Sis	UTSW	3	72,828,475 (GRCm39)	missense	probably damaging	1.00
R8053:Sis	UTSW	3	72,856,901 (GRCm39)	nonsense	probably null
R8062:Sis	UTSW	3	72,828,321 (GRCm39)	nonsense	probably null
R8074:Sis	UTSW	3	72,824,531 (GRCm39)	missense	probably damaging	1.00
R8085:Sis	UTSW	3	72,814,462 (GRCm39)	missense	probably damaging	1.00
R8137:Sis	UTSW	3	72,796,378 (GRCm39)	missense	probably benign	0.22
R8349:Sis	UTSW	3	72,810,984 (GRCm39)	missense	probably damaging	1.00
R8354:Sis	UTSW	3	72,854,834 (GRCm39)	missense	possibly damaging	0.84
R8366:Sis	UTSW	3	72,865,566 (GRCm39)	missense	probably damaging	1.00
R8449:Sis	UTSW	3	72,810,984 (GRCm39)	missense	probably damaging	1.00
R8454:Sis	UTSW	3	72,854,834 (GRCm39)	missense	possibly damaging	0.84
R8474:Sis	UTSW	3	72,836,730 (GRCm39)	missense	probably damaging	1.00
R8515:Sis	UTSW	3	72,836,742 (GRCm39)	missense	probably benign	0.00
R8680:Sis	UTSW	3	72,867,628 (GRCm39)	missense	probably damaging	1.00
R8703:Sis	UTSW	3	72,867,657 (GRCm39)	missense	probably damaging	1.00
R9098:Sis	UTSW	3	72,844,578 (GRCm39)	missense	possibly damaging	0.66
R9466:Sis	UTSW	3	72,872,910 (GRCm39)	critical splice donor site	probably null
R9574:Sis	UTSW	3	72,828,490 (GRCm39)	missense	probably benign	0.05
R9630:Sis	UTSW	3	72,828,722 (GRCm39)	missense	probably benign	0.11
R9680:Sis	UTSW	3	72,863,621 (GRCm39)	missense	probably benign	0.12
R9709:Sis	UTSW	3	72,799,074 (GRCm39)	missense	possibly damaging	0.47
R9731:Sis	UTSW	3	72,835,543 (GRCm39)	missense	probably benign	0.01
X0009:Sis	UTSW	3	72,796,355 (GRCm39)	missense	probably damaging	0.99
X0024:Sis	UTSW	3	72,836,003 (GRCm39)	missense	probably benign
X0060:Sis	UTSW	3	72,828,239 (GRCm39)	intron	probably benign
Z1176:Sis	UTSW	3	72,850,890 (GRCm39)	missense	probably benign	0.25
Z1176:Sis	UTSW	3	72,811,606 (GRCm39)	missense	probably benign	0.05
Z1177:Sis	UTSW	3	72,850,902 (GRCm39)	missense	probably damaging	1.00
Z1177:Sis	UTSW	3	72,817,807 (GRCm39)	missense	probably damaging	1.00
Z1177:Sis	UTSW	3	72,816,505 (GRCm39)	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- GTGGAGTCAAATATCTATGACTGC -3'
(R):5'- TCTAGTATAGACATTGTTCTGGGTCC -3'

Sequencing Primer
(F):5'- GCCCATTGCATTGCTGT -3'
(R):5'- GTGTGTGTGTTAAAATCAGCACAGC -3'

Posted On

2017-08-16