Incidental Mutation 'R6091:Olfr1107'
ID485905
Institutional Source Beutler Lab
Gene Symbol Olfr1107
Ensembl Gene ENSMUSG00000075163
Gene Nameolfactory receptor 1107
SynonymsGA_x6K02T2Q125-48565383-48564445, MOR172-2
MMRRC Submission 044248-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R6091 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87068671-87075817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87071361 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 258 (S258C)
Ref Sequence ENSEMBL: ENSMUSP00000150135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099865] [ENSMUST00000214049]
Predicted Effect probably benign
Transcript: ENSMUST00000099865
AA Change: S258C

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000097450
Gene: ENSMUSG00000075163
AA Change: S258C

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.9e-53 PFAM
Pfam:7tm_1 41 290 1.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214049
AA Change: S258C

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T G 2: 35,362,336 T50P possibly damaging Het
Adad1 A G 3: 37,084,969 E396G possibly damaging Het
Adamtsl3 T A 7: 82,465,621 C232S probably damaging Het
AI606181 T C 19: 41,593,624 S78P unknown Het
Amph T A 13: 19,125,123 M457K probably benign Het
Ano1 A T 7: 144,669,434 M174K probably benign Het
C3 T A 17: 57,221,967 K632* probably null Het
Cep170 C T 1: 176,755,831 G994D probably damaging Het
Chd7 T C 4: 8,751,875 V124A probably damaging Het
Chd9 A G 8: 91,035,063 K2259E probably damaging Het
Col7a1 A G 9: 108,955,334 T137A unknown Het
Dcc C T 18: 71,809,114 V311I probably benign Het
Ddx42 A T 11: 106,234,970 Q282L probably damaging Het
Fcgbp A G 7: 28,104,965 T1833A possibly damaging Het
Fpr-rs3 A G 17: 20,624,270 I203T probably benign Het
Frem1 A G 4: 82,900,559 I2139T probably benign Het
Frmpd2 T C 14: 33,522,863 V546A probably damaging Het
Gbp11 G T 5: 105,331,388 T123N possibly damaging Het
Hs3st1 G A 5: 39,614,664 P212L probably damaging Het
Ifnb1 T A 4: 88,522,576 M67L probably benign Het
Ighv1-54 T C 12: 115,193,877 N50S probably benign Het
Ikzf4 G A 10: 128,634,673 T326I probably benign Het
Ints2 A T 11: 86,236,603 V501E probably damaging Het
Mfsd1 C A 3: 67,599,937 probably null Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mrps11 G A 7: 78,788,718 A73T possibly damaging Het
Mterf4 T C 1: 93,301,569 E311G probably damaging Het
Mx2 A G 16: 97,546,435 T176A probably damaging Het
Mycbp2 A C 14: 103,223,046 L1495R probably damaging Het
Myo3b A G 2: 70,238,769 T451A probably benign Het
Myrfl T C 10: 116,849,206 T90A probably benign Het
Nbeal1 A G 1: 60,181,556 probably benign Het
Ncor1 A G 11: 62,419,617 L201P probably damaging Het
Nfxl1 G T 5: 72,514,190 L909I probably benign Het
Nr3c1 GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC 18: 39,486,958 probably benign Het
Plscr5 A G 9: 92,204,384 T136A probably benign Het
Ppp1r3a G A 6: 14,719,340 T525I probably benign Het
Ptprg G A 14: 12,215,979 G1143R probably damaging Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Ryr1 T C 7: 29,071,973 T2541A probably benign Het
Sall1 A G 8: 89,028,619 L1244P probably damaging Het
Sec16a G A 2: 26,426,470 H1673Y probably damaging Het
Slc22a19 A G 19: 7,711,063 I44T probably benign Het
Snap91 T A 9: 86,839,628 N53Y probably damaging Het
Sorcs1 T C 19: 50,288,101 T338A possibly damaging Het
Taf6l T C 19: 8,778,556 T243A probably benign Het
Tex10 T C 4: 48,459,891 R487G probably damaging Het
Tfcp2 G T 15: 100,512,313 T391N probably damaging Het
Tnxb G A 17: 34,710,364 V2794M probably damaging Het
Ush2a T G 1: 188,399,803 C741G probably damaging Het
Vmn1r3 T A 4: 3,184,684 I208F probably damaging Het
Vmn2r28 T A 7: 5,493,791 I21F possibly damaging Het
Vmn2r93 A G 17: 18,325,696 D610G probably benign Het
Wbp1 T C 6: 83,119,487 S229G probably benign Het
Xirp1 A G 9: 120,017,963 V618A probably benign Het
Zbtb32 A G 7: 30,591,829 S14P possibly damaging Het
Zfp24 A G 18: 24,014,212 S348P probably damaging Het
Other mutations in Olfr1107
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Olfr1107 APN 2 87071219 missense probably benign 0.00
IGL01521:Olfr1107 APN 2 87071733 missense probably benign 0.11
IGL03350:Olfr1107 APN 2 87071560 missense probably damaging 1.00
PIT4791001:Olfr1107 UTSW 2 87071702 missense possibly damaging 0.94
R0801:Olfr1107 UTSW 2 87072063 nonsense probably null
R1383:Olfr1107 UTSW 2 87071792 missense probably damaging 1.00
R1577:Olfr1107 UTSW 2 87071397 missense probably benign 0.15
R1762:Olfr1107 UTSW 2 87071921 missense probably damaging 1.00
R2027:Olfr1107 UTSW 2 87071553 missense possibly damaging 0.85
R3850:Olfr1107 UTSW 2 87071966 missense possibly damaging 0.89
R5345:Olfr1107 UTSW 2 87071492 missense possibly damaging 0.61
R5409:Olfr1107 UTSW 2 87071870 missense possibly damaging 0.64
R5451:Olfr1107 UTSW 2 87071997 missense probably damaging 1.00
R5735:Olfr1107 UTSW 2 87071412 missense probably damaging 1.00
R6869:Olfr1107 UTSW 2 87071673 missense probably benign 0.11
R7080:Olfr1107 UTSW 2 87071739 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACCAAGCTTTCTAAGTCAGAG -3'
(R):5'- ATGCACACAACAATGAGATGCTG -3'

Sequencing Primer
(F):5'- CCAAGCTTTCTAAGTCAGAGAAGTG -3'
(R):5'- CAACAATGAGATGCTGCTTTTGGTC -3'
Posted On2017-08-16