Incidental Mutation 'R6091:Hs3st1'
ID485914
Institutional Source Beutler Lab
Gene Symbol Hs3st1
Ensembl Gene ENSMUSG00000051022
Gene Nameheparan sulfate (glucosamine) 3-O-sulfotransferase 1
SynonymsD5Wsu110e, 3-OST
MMRRC Submission 044248-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R6091 (G1)
Quality Score219.009
Status Validated
Chromosome5
Chromosomal Location39613935-39755475 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 39614664 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 212 (P212L)
Ref Sequence ENSEMBL: ENSMUSP00000113919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053116] [ENSMUST00000117944] [ENSMUST00000137142] [ENSMUST00000152057]
Predicted Effect probably damaging
Transcript: ENSMUST00000053116
AA Change: P212L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051055
Gene: ENSMUSG00000051022
AA Change: P212L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Sulfotransfer_1 58 302 5.7e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117944
AA Change: P212L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113919
Gene: ENSMUSG00000051022
AA Change: P212L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Sulfotransfer_1 58 302 5.7e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137142
SMART Domains Protein: ENSMUSP00000114997
Gene: ENSMUSG00000051022

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Sulfotransfer_1 58 177 3.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152057
SMART Domains Protein: ENSMUSP00000118060
Gene: ENSMUSG00000051022

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1fmja_ 25 74 1e-5 SMART
PDB:1VKJ|C 40 75 6e-12 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200697
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heparan sulfate biosynthetic enzymes are key components in generating a myriad of distinct heparan sulfate fine structures that carry out multiple biologic activities. The enzyme encoded by this gene is a member of the heparan sulfate biosynthetic enzyme family. It possesses both heparan sulfate glucosaminyl 3-O-sulfotransferase activity, anticoagulant heparan sulfate conversion activity, and is a rate limiting enzyme for synthesis of anticoagulant heparan. This enzyme is an intraluminal Golgi resident protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic growth retardation and death between postnatal days 2-3 when bred on a C57BL/6J background. Mice homozygous for this mutation on a 129 background are normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T G 2: 35,362,336 T50P possibly damaging Het
Adad1 A G 3: 37,084,969 E396G possibly damaging Het
Adamtsl3 T A 7: 82,465,621 C232S probably damaging Het
AI606181 T C 19: 41,593,624 S78P unknown Het
Amph T A 13: 19,125,123 M457K probably benign Het
Ano1 A T 7: 144,669,434 M174K probably benign Het
C3 T A 17: 57,221,967 K632* probably null Het
Cep170 C T 1: 176,755,831 G994D probably damaging Het
Chd7 T C 4: 8,751,875 V124A probably damaging Het
Chd9 A G 8: 91,035,063 K2259E probably damaging Het
Col7a1 A G 9: 108,955,334 T137A unknown Het
Dcc C T 18: 71,809,114 V311I probably benign Het
Ddx42 A T 11: 106,234,970 Q282L probably damaging Het
Fcgbp A G 7: 28,104,965 T1833A possibly damaging Het
Fpr-rs3 A G 17: 20,624,270 I203T probably benign Het
Frem1 A G 4: 82,900,559 I2139T probably benign Het
Frmpd2 T C 14: 33,522,863 V546A probably damaging Het
Gbp11 G T 5: 105,331,388 T123N possibly damaging Het
Ifnb1 T A 4: 88,522,576 M67L probably benign Het
Ighv1-54 T C 12: 115,193,877 N50S probably benign Het
Ikzf4 G A 10: 128,634,673 T326I probably benign Het
Ints2 A T 11: 86,236,603 V501E probably damaging Het
Mfsd1 C A 3: 67,599,937 probably null Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mrps11 G A 7: 78,788,718 A73T possibly damaging Het
Mterf4 T C 1: 93,301,569 E311G probably damaging Het
Mx2 A G 16: 97,546,435 T176A probably damaging Het
Mycbp2 A C 14: 103,223,046 L1495R probably damaging Het
Myo3b A G 2: 70,238,769 T451A probably benign Het
Myrfl T C 10: 116,849,206 T90A probably benign Het
Nbeal1 A G 1: 60,181,556 probably benign Het
Ncor1 A G 11: 62,419,617 L201P probably damaging Het
Nfxl1 G T 5: 72,514,190 L909I probably benign Het
Nr3c1 GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC 18: 39,486,958 probably benign Het
Olfr1107 T A 2: 87,071,361 S258C probably benign Het
Plscr5 A G 9: 92,204,384 T136A probably benign Het
Ppp1r3a G A 6: 14,719,340 T525I probably benign Het
Ptprg G A 14: 12,215,979 G1143R probably damaging Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Ryr1 T C 7: 29,071,973 T2541A probably benign Het
Sall1 A G 8: 89,028,619 L1244P probably damaging Het
Sec16a G A 2: 26,426,470 H1673Y probably damaging Het
Slc22a19 A G 19: 7,711,063 I44T probably benign Het
Snap91 T A 9: 86,839,628 N53Y probably damaging Het
Sorcs1 T C 19: 50,288,101 T338A possibly damaging Het
Taf6l T C 19: 8,778,556 T243A probably benign Het
Tex10 T C 4: 48,459,891 R487G probably damaging Het
Tfcp2 G T 15: 100,512,313 T391N probably damaging Het
Tnxb G A 17: 34,710,364 V2794M probably damaging Het
Ush2a T G 1: 188,399,803 C741G probably damaging Het
Vmn1r3 T A 4: 3,184,684 I208F probably damaging Het
Vmn2r28 T A 7: 5,493,791 I21F possibly damaging Het
Vmn2r93 A G 17: 18,325,696 D610G probably benign Het
Wbp1 T C 6: 83,119,487 S229G probably benign Het
Xirp1 A G 9: 120,017,963 V618A probably benign Het
Zbtb32 A G 7: 30,591,829 S14P possibly damaging Het
Zfp24 A G 18: 24,014,212 S348P probably damaging Het
Other mutations in Hs3st1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02823:Hs3st1 APN 5 39614757 missense probably damaging 1.00
IGL03162:Hs3st1 APN 5 39614449 nonsense probably null
R1105:Hs3st1 UTSW 5 39614698 unclassified probably benign
R1539:Hs3st1 UTSW 5 39614448 missense probably benign
R1577:Hs3st1 UTSW 5 39615050 missense probably benign 0.01
R3857:Hs3st1 UTSW 5 39614913 missense probably damaging 1.00
R3858:Hs3st1 UTSW 5 39614913 missense probably damaging 1.00
R4730:Hs3st1 UTSW 5 39614805 nonsense probably null
R6194:Hs3st1 UTSW 5 39614405 missense probably damaging 0.96
R6213:Hs3st1 UTSW 5 39614521 missense probably damaging 1.00
R6292:Hs3st1 UTSW 5 39614790 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TAGTTTGGGATCCACCTGGG -3'
(R):5'- TTATCCTGAGGGACCCATCAG -3'

Sequencing Primer
(F):5'- CCTTTGGACTCGTGTAAGCAGC -3'
(R):5'- ACCCATCAGAGCGCGTG -3'
Posted On2017-08-16