Incidental Mutation 'R6091:Ddx42'
ID485937
Institutional Source Beutler Lab
Gene Symbol Ddx42
Ensembl Gene ENSMUSG00000020705
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 42
SynonymsB430002H05Rik, SF3b125, 1810047H21Rik
MMRRC Submission 044248-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.754) question?
Stock #R6091 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location106216926-106249139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106234970 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 282 (Q282L)
Ref Sequence ENSEMBL: ENSMUSP00000021046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021046]
Predicted Effect probably damaging
Transcript: ENSMUST00000021046
AA Change: Q282L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000021046
Gene: ENSMUSG00000020705
AA Change: Q282L

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
low complexity region 35 52 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
low complexity region 108 114 N/A INTRINSIC
coiled coil region 116 143 N/A INTRINSIC
low complexity region 149 158 N/A INTRINSIC
DEXDc 272 474 7.61e-68 SMART
HELICc 512 593 1.58e-33 SMART
low complexity region 644 659 N/A INTRINSIC
low complexity region 722 737 N/A INTRINSIC
low complexity region 814 838 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152860
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Asp-Glu-Ala-Asp (DEAD) box protein family. Members of this protein family are putative RNA helicases, and are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T G 2: 35,362,336 T50P possibly damaging Het
Adad1 A G 3: 37,084,969 E396G possibly damaging Het
Adamtsl3 T A 7: 82,465,621 C232S probably damaging Het
AI606181 T C 19: 41,593,624 S78P unknown Het
Amph T A 13: 19,125,123 M457K probably benign Het
Ano1 A T 7: 144,669,434 M174K probably benign Het
C3 T A 17: 57,221,967 K632* probably null Het
Cep170 C T 1: 176,755,831 G994D probably damaging Het
Chd7 T C 4: 8,751,875 V124A probably damaging Het
Chd9 A G 8: 91,035,063 K2259E probably damaging Het
Col7a1 A G 9: 108,955,334 T137A unknown Het
Dcc C T 18: 71,809,114 V311I probably benign Het
Fcgbp A G 7: 28,104,965 T1833A possibly damaging Het
Fpr-rs3 A G 17: 20,624,270 I203T probably benign Het
Frem1 A G 4: 82,900,559 I2139T probably benign Het
Frmpd2 T C 14: 33,522,863 V546A probably damaging Het
Gbp11 G T 5: 105,331,388 T123N possibly damaging Het
Hs3st1 G A 5: 39,614,664 P212L probably damaging Het
Ifnb1 T A 4: 88,522,576 M67L probably benign Het
Ighv1-54 T C 12: 115,193,877 N50S probably benign Het
Ikzf4 G A 10: 128,634,673 T326I probably benign Het
Ints2 A T 11: 86,236,603 V501E probably damaging Het
Mfsd1 C A 3: 67,599,937 probably null Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mrps11 G A 7: 78,788,718 A73T possibly damaging Het
Mterf4 T C 1: 93,301,569 E311G probably damaging Het
Mx2 A G 16: 97,546,435 T176A probably damaging Het
Mycbp2 A C 14: 103,223,046 L1495R probably damaging Het
Myo3b A G 2: 70,238,769 T451A probably benign Het
Myrfl T C 10: 116,849,206 T90A probably benign Het
Nbeal1 A G 1: 60,181,556 probably benign Het
Ncor1 A G 11: 62,419,617 L201P probably damaging Het
Nfxl1 G T 5: 72,514,190 L909I probably benign Het
Nr3c1 GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC 18: 39,486,958 probably benign Het
Olfr1107 T A 2: 87,071,361 S258C probably benign Het
Plscr5 A G 9: 92,204,384 T136A probably benign Het
Ppp1r3a G A 6: 14,719,340 T525I probably benign Het
Ptprg G A 14: 12,215,979 G1143R probably damaging Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Ryr1 T C 7: 29,071,973 T2541A probably benign Het
Sall1 A G 8: 89,028,619 L1244P probably damaging Het
Sec16a G A 2: 26,426,470 H1673Y probably damaging Het
Slc22a19 A G 19: 7,711,063 I44T probably benign Het
Snap91 T A 9: 86,839,628 N53Y probably damaging Het
Sorcs1 T C 19: 50,288,101 T338A possibly damaging Het
Taf6l T C 19: 8,778,556 T243A probably benign Het
Tex10 T C 4: 48,459,891 R487G probably damaging Het
Tfcp2 G T 15: 100,512,313 T391N probably damaging Het
Tnxb G A 17: 34,710,364 V2794M probably damaging Het
Ush2a T G 1: 188,399,803 C741G probably damaging Het
Vmn1r3 T A 4: 3,184,684 I208F probably damaging Het
Vmn2r28 T A 7: 5,493,791 I21F possibly damaging Het
Vmn2r93 A G 17: 18,325,696 D610G probably benign Het
Wbp1 T C 6: 83,119,487 S229G probably benign Het
Xirp1 A G 9: 120,017,963 V618A probably benign Het
Zbtb32 A G 7: 30,591,829 S14P possibly damaging Het
Zfp24 A G 18: 24,014,212 S348P probably damaging Het
Other mutations in Ddx42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Ddx42 APN 11 106235749 missense probably damaging 0.98
IGL00833:Ddx42 APN 11 106231178 missense possibly damaging 0.52
IGL01095:Ddx42 APN 11 106247499 missense probably damaging 1.00
IGL01651:Ddx42 APN 11 106248029 missense probably benign 0.00
IGL01715:Ddx42 APN 11 106224275 missense probably damaging 1.00
IGL02097:Ddx42 APN 11 106239160 missense probably benign 0.00
IGL03182:Ddx42 APN 11 106247527 missense probably benign
P0045:Ddx42 UTSW 11 106231272 missense probably damaging 1.00
R0504:Ddx42 UTSW 11 106247849 missense probably benign 0.03
R0646:Ddx42 UTSW 11 106232833 missense probably benign 0.00
R2277:Ddx42 UTSW 11 106242939 missense probably damaging 1.00
R2279:Ddx42 UTSW 11 106242939 missense probably damaging 1.00
R2297:Ddx42 UTSW 11 106242939 missense probably damaging 1.00
R2336:Ddx42 UTSW 11 106231150 missense possibly damaging 0.56
R2519:Ddx42 UTSW 11 106245329 missense probably damaging 1.00
R3413:Ddx42 UTSW 11 106247810 missense probably benign 0.00
R3498:Ddx42 UTSW 11 106231193 missense possibly damaging 0.90
R3883:Ddx42 UTSW 11 106247692 missense probably benign 0.03
R4421:Ddx42 UTSW 11 106231138 missense probably damaging 1.00
R4696:Ddx42 UTSW 11 106247703 missense probably benign 0.09
R4953:Ddx42 UTSW 11 106242940 missense probably damaging 1.00
R5398:Ddx42 UTSW 11 106224898 missense probably benign
R5669:Ddx42 UTSW 11 106241819 missense probably damaging 1.00
R6139:Ddx42 UTSW 11 106240017 missense probably damaging 1.00
R6643:Ddx42 UTSW 11 106228820 missense probably benign 0.14
R6991:Ddx42 UTSW 11 106239144 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTAAAGTGCTTGGTCTGAG -3'
(R):5'- GGGATTCTAGTCATTGAAAGCAC -3'

Sequencing Primer
(F):5'- GTGCACTGTTGAACTGTAAATGC -3'
(R):5'- TGAAAGCACAAAGTATATCCATGGAC -3'
Posted On2017-08-16