Incidental Mutation 'R6091:Mx2'
ID485944
Institutional Source Beutler Lab
Gene Symbol Mx2
Ensembl Gene ENSMUSG00000023341
Gene NameMX dynamin-like GTPase 2
SynonymsMx-2
MMRRC Submission 044248-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R6091 (G1)
Quality Score191.009
Status Validated
Chromosome16
Chromosomal Location97535308-97560900 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97546435 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 176 (T176A)
Ref Sequence ENSEMBL: ENSMUSP00000141038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024112] [ENSMUST00000188251] [ENSMUST00000190447]
Predicted Effect probably damaging
Transcript: ENSMUST00000024112
AA Change: T176A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000024112
Gene: ENSMUSG00000023341
AA Change: T176A

DomainStartEndE-ValueType
DYNc 39 282 2.71e-135 SMART
Blast:DYNc 426 539 4e-17 BLAST
GED 562 653 9.88e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188251
AA Change: T176A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000141038
Gene: ENSMUSG00000023341
AA Change: T176A

DomainStartEndE-ValueType
DYNc 39 282 1.3e-137 SMART
low complexity region 592 603 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190097
Predicted Effect probably benign
Transcript: ENSMUST00000190447
AA Change: T176A

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140229
Gene: ENSMUSG00000023341
AA Change: T176A

DomainStartEndE-ValueType
DYNc 39 282 1.3e-137 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency 96% (54/56)
MGI Phenotype Mx1+ strains do not express MX2 protein. The Mx2 gene in BALB/cJ and CBA/J is interrupted by an open reading frame mutation. Mutagenesis correcting the frameshift permits Mx2 expression in 3T3 cells. This protein did not inhibit influenza virus but conferred resistance to vesicular stomatitis virus.
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T G 2: 35,362,336 T50P possibly damaging Het
Adad1 A G 3: 37,084,969 E396G possibly damaging Het
Adamtsl3 T A 7: 82,465,621 C232S probably damaging Het
AI606181 T C 19: 41,593,624 S78P unknown Het
Amph T A 13: 19,125,123 M457K probably benign Het
Ano1 A T 7: 144,669,434 M174K probably benign Het
C3 T A 17: 57,221,967 K632* probably null Het
Cep170 C T 1: 176,755,831 G994D probably damaging Het
Chd7 T C 4: 8,751,875 V124A probably damaging Het
Chd9 A G 8: 91,035,063 K2259E probably damaging Het
Col7a1 A G 9: 108,955,334 T137A unknown Het
Dcc C T 18: 71,809,114 V311I probably benign Het
Ddx42 A T 11: 106,234,970 Q282L probably damaging Het
Fcgbp A G 7: 28,104,965 T1833A possibly damaging Het
Fpr-rs3 A G 17: 20,624,270 I203T probably benign Het
Frem1 A G 4: 82,900,559 I2139T probably benign Het
Frmpd2 T C 14: 33,522,863 V546A probably damaging Het
Gbp11 G T 5: 105,331,388 T123N possibly damaging Het
Hs3st1 G A 5: 39,614,664 P212L probably damaging Het
Ifnb1 T A 4: 88,522,576 M67L probably benign Het
Ighv1-54 T C 12: 115,193,877 N50S probably benign Het
Ikzf4 G A 10: 128,634,673 T326I probably benign Het
Ints2 A T 11: 86,236,603 V501E probably damaging Het
Mfsd1 C A 3: 67,599,937 probably null Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mrps11 G A 7: 78,788,718 A73T possibly damaging Het
Mterf4 T C 1: 93,301,569 E311G probably damaging Het
Mycbp2 A C 14: 103,223,046 L1495R probably damaging Het
Myo3b A G 2: 70,238,769 T451A probably benign Het
Myrfl T C 10: 116,849,206 T90A probably benign Het
Nbeal1 A G 1: 60,181,556 probably benign Het
Ncor1 A G 11: 62,419,617 L201P probably damaging Het
Nfxl1 G T 5: 72,514,190 L909I probably benign Het
Nr3c1 GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC 18: 39,486,958 probably benign Het
Olfr1107 T A 2: 87,071,361 S258C probably benign Het
Plscr5 A G 9: 92,204,384 T136A probably benign Het
Ppp1r3a G A 6: 14,719,340 T525I probably benign Het
Ptprg G A 14: 12,215,979 G1143R probably damaging Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Ryr1 T C 7: 29,071,973 T2541A probably benign Het
Sall1 A G 8: 89,028,619 L1244P probably damaging Het
Sec16a G A 2: 26,426,470 H1673Y probably damaging Het
Slc22a19 A G 19: 7,711,063 I44T probably benign Het
Snap91 T A 9: 86,839,628 N53Y probably damaging Het
Sorcs1 T C 19: 50,288,101 T338A possibly damaging Het
Taf6l T C 19: 8,778,556 T243A probably benign Het
Tex10 T C 4: 48,459,891 R487G probably damaging Het
Tfcp2 G T 15: 100,512,313 T391N probably damaging Het
Tnxb G A 17: 34,710,364 V2794M probably damaging Het
Ush2a T G 1: 188,399,803 C741G probably damaging Het
Vmn1r3 T A 4: 3,184,684 I208F probably damaging Het
Vmn2r28 T A 7: 5,493,791 I21F possibly damaging Het
Vmn2r93 A G 17: 18,325,696 D610G probably benign Het
Wbp1 T C 6: 83,119,487 S229G probably benign Het
Xirp1 A G 9: 120,017,963 V618A probably benign Het
Zbtb32 A G 7: 30,591,829 S14P possibly damaging Het
Zfp24 A G 18: 24,014,212 S348P probably damaging Het
Other mutations in Mx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Mx2 APN 16 97544478 missense probably damaging 0.99
IGL01111:Mx2 APN 16 97558719 missense probably benign
IGL02103:Mx2 APN 16 97544595 missense probably damaging 1.00
IGL02678:Mx2 APN 16 97556120 critical splice donor site probably null
IGL03166:Mx2 APN 16 97546790 missense probably damaging 1.00
IGL03323:Mx2 APN 16 97546375 missense probably damaging 0.99
R0254:Mx2 UTSW 16 97556095 missense probably benign
R0699:Mx2 UTSW 16 97544553 missense probably damaging 1.00
R1180:Mx2 UTSW 16 97556009 missense probably damaging 1.00
R1702:Mx2 UTSW 16 97558683 missense probably benign
R1762:Mx2 UTSW 16 97538703 missense probably benign 0.09
R1922:Mx2 UTSW 16 97560351 missense probably benign 0.05
R2049:Mx2 UTSW 16 97538703 missense probably benign 0.09
R2141:Mx2 UTSW 16 97538703 missense probably benign 0.09
R2142:Mx2 UTSW 16 97538703 missense probably benign 0.09
R3010:Mx2 UTSW 16 97546799 missense possibly damaging 0.85
R4079:Mx2 UTSW 16 97556036 missense probably damaging 0.98
R4553:Mx2 UTSW 16 97552005 missense possibly damaging 0.52
R4594:Mx2 UTSW 16 97547432 nonsense probably null
R5211:Mx2 UTSW 16 97547433 missense probably damaging 1.00
R5785:Mx2 UTSW 16 97538704 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CATAGCCAAGGCATGCTTTTCC -3'
(R):5'- TGAGGTTGTGGTAAAGCCTAGC -3'

Sequencing Primer
(F):5'- GAATTCTCTGGAATAAGATCCCCTC -3'
(R):5'- GTGGTAAAGCCTAGCTATCCAGTC -3'
Posted On2017-08-16