Incidental Mutation 'R6091:Taf6l'
ID485953
Institutional Source Beutler Lab
Gene Symbol Taf6l
Ensembl Gene ENSMUSG00000003680
Gene NameTATA-box binding protein associated factor 6 like
SynonymsPAF65A, 2810417N14Rik, C530024J06Rik
MMRRC Submission 044248-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.923) question?
Stock #R6091 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location8772522-8786417 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8778556 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 243 (T243A)
Ref Sequence ENSEMBL: ENSMUSP00000140136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003777] [ENSMUST00000010249] [ENSMUST00000176496] [ENSMUST00000176610] [ENSMUST00000177056] [ENSMUST00000177216] [ENSMUST00000189739]
Predicted Effect probably benign
Transcript: ENSMUST00000003777
AA Change: T268A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000003777
Gene: ENSMUSG00000003680
AA Change: T268A

DomainStartEndE-ValueType
TAF 16 79 9.03e-28 SMART
Pfam:DUF1546 248 339 4.5e-29 PFAM
low complexity region 565 576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000010249
SMART Domains Protein: ENSMUSP00000010249
Gene: ENSMUSG00000003680

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 45 62 N/A INTRINSIC
transmembrane domain 64 86 N/A INTRINSIC
transmembrane domain 98 120 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176080
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176331
Predicted Effect probably benign
Transcript: ENSMUST00000176496
AA Change: T244A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000135090
Gene: ENSMUSG00000003680
AA Change: T244A

DomainStartEndE-ValueType
TAF 17 80 9.03e-28 SMART
Pfam:DUF1546 224 315 4.3e-29 PFAM
low complexity region 541 552 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176610
AA Change: T269A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000135193
Gene: ENSMUSG00000003680
AA Change: T269A

DomainStartEndE-ValueType
TAF 17 80 9.03e-28 SMART
Pfam:TAF6_C 249 338 6.6e-22 PFAM
low complexity region 566 577 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176747
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176991
Predicted Effect probably benign
Transcript: ENSMUST00000177056
AA Change: T262A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135028
Gene: ENSMUSG00000003680
AA Change: T262A

DomainStartEndE-ValueType
TAF 10 73 9.03e-28 SMART
Pfam:DUF1546 242 333 4.5e-29 PFAM
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177216
AA Change: T269A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000135220
Gene: ENSMUSG00000003680
AA Change: T269A

DomainStartEndE-ValueType
TAF 17 80 9.03e-28 SMART
Pfam:DUF1546 249 340 6.4e-29 PFAM
low complexity region 566 577 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189739
AA Change: T243A

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000140136
Gene: ENSMUSG00000003680
AA Change: T243A

DomainStartEndE-ValueType
TAF 16 79 3.8e-31 SMART
Pfam:DUF1546 223 314 6.3e-26 PFAM
low complexity region 540 551 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes a protein that is a component of the PCAF histone acetylase complex and structurally similar to one of the histone-like TAFs, TAF6. The PCAF histone acetylase complex, which is composed of more than 20 polypeptides some of which are TAFs, is required for myogenic transcription and differentiation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T G 2: 35,362,336 T50P possibly damaging Het
Adad1 A G 3: 37,084,969 E396G possibly damaging Het
Adamtsl3 T A 7: 82,465,621 C232S probably damaging Het
AI606181 T C 19: 41,593,624 S78P unknown Het
Amph T A 13: 19,125,123 M457K probably benign Het
Ano1 A T 7: 144,669,434 M174K probably benign Het
C3 T A 17: 57,221,967 K632* probably null Het
Cep170 C T 1: 176,755,831 G994D probably damaging Het
Chd7 T C 4: 8,751,875 V124A probably damaging Het
Chd9 A G 8: 91,035,063 K2259E probably damaging Het
Col7a1 A G 9: 108,955,334 T137A unknown Het
Dcc C T 18: 71,809,114 V311I probably benign Het
Ddx42 A T 11: 106,234,970 Q282L probably damaging Het
Fcgbp A G 7: 28,104,965 T1833A possibly damaging Het
Fpr-rs3 A G 17: 20,624,270 I203T probably benign Het
Frem1 A G 4: 82,900,559 I2139T probably benign Het
Frmpd2 T C 14: 33,522,863 V546A probably damaging Het
Gbp11 G T 5: 105,331,388 T123N possibly damaging Het
Hs3st1 G A 5: 39,614,664 P212L probably damaging Het
Ifnb1 T A 4: 88,522,576 M67L probably benign Het
Ighv1-54 T C 12: 115,193,877 N50S probably benign Het
Ikzf4 G A 10: 128,634,673 T326I probably benign Het
Ints2 A T 11: 86,236,603 V501E probably damaging Het
Mfsd1 C A 3: 67,599,937 probably null Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mrps11 G A 7: 78,788,718 A73T possibly damaging Het
Mterf4 T C 1: 93,301,569 E311G probably damaging Het
Mx2 A G 16: 97,546,435 T176A probably damaging Het
Mycbp2 A C 14: 103,223,046 L1495R probably damaging Het
Myo3b A G 2: 70,238,769 T451A probably benign Het
Myrfl T C 10: 116,849,206 T90A probably benign Het
Nbeal1 A G 1: 60,181,556 probably benign Het
Ncor1 A G 11: 62,419,617 L201P probably damaging Het
Nfxl1 G T 5: 72,514,190 L909I probably benign Het
Nr3c1 GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC 18: 39,486,958 probably benign Het
Olfr1107 T A 2: 87,071,361 S258C probably benign Het
Plscr5 A G 9: 92,204,384 T136A probably benign Het
Ppp1r3a G A 6: 14,719,340 T525I probably benign Het
Ptprg G A 14: 12,215,979 G1143R probably damaging Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Ryr1 T C 7: 29,071,973 T2541A probably benign Het
Sall1 A G 8: 89,028,619 L1244P probably damaging Het
Sec16a G A 2: 26,426,470 H1673Y probably damaging Het
Slc22a19 A G 19: 7,711,063 I44T probably benign Het
Snap91 T A 9: 86,839,628 N53Y probably damaging Het
Sorcs1 T C 19: 50,288,101 T338A possibly damaging Het
Tex10 T C 4: 48,459,891 R487G probably damaging Het
Tfcp2 G T 15: 100,512,313 T391N probably damaging Het
Tnxb G A 17: 34,710,364 V2794M probably damaging Het
Ush2a T G 1: 188,399,803 C741G probably damaging Het
Vmn1r3 T A 4: 3,184,684 I208F probably damaging Het
Vmn2r28 T A 7: 5,493,791 I21F possibly damaging Het
Vmn2r93 A G 17: 18,325,696 D610G probably benign Het
Wbp1 T C 6: 83,119,487 S229G probably benign Het
Xirp1 A G 9: 120,017,963 V618A probably benign Het
Zbtb32 A G 7: 30,591,829 S14P possibly damaging Het
Zfp24 A G 18: 24,014,212 S348P probably damaging Het
Other mutations in Taf6l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Taf6l APN 19 8783388 missense probably benign 0.04
IGL00781:Taf6l APN 19 8773661 missense probably damaging 1.00
IGL01886:Taf6l APN 19 8778086 critical splice donor site probably null
IGL02638:Taf6l APN 19 8775266 missense probably benign 0.03
IGL02676:Taf6l APN 19 8775049 missense probably damaging 1.00
R0096:Taf6l UTSW 19 8778517 missense probably benign 0.06
R0110:Taf6l UTSW 19 8778521 missense probably benign 0.08
R0469:Taf6l UTSW 19 8778521 missense probably benign 0.08
R0510:Taf6l UTSW 19 8778521 missense probably benign 0.08
R0676:Taf6l UTSW 19 8773369 missense probably benign 0.00
R0711:Taf6l UTSW 19 8778517 missense probably benign 0.06
R1804:Taf6l UTSW 19 8773634 missense probably damaging 0.99
R1971:Taf6l UTSW 19 8775502 unclassified probably null
R2869:Taf6l UTSW 19 8778628 unclassified probably benign
R2870:Taf6l UTSW 19 8778628 unclassified probably benign
R3105:Taf6l UTSW 19 8778855 missense probably damaging 1.00
R4578:Taf6l UTSW 19 8783971 missense possibly damaging 0.95
R4581:Taf6l UTSW 19 8778208 missense probably damaging 0.99
R4841:Taf6l UTSW 19 8782406 missense possibly damaging 0.77
R4842:Taf6l UTSW 19 8782406 missense possibly damaging 0.77
R5215:Taf6l UTSW 19 8778053 intron probably benign
R5269:Taf6l UTSW 19 8774962 missense probably damaging 1.00
R5571:Taf6l UTSW 19 8783930 missense probably damaging 1.00
R5687:Taf6l UTSW 19 8773312 missense probably benign 0.01
R5799:Taf6l UTSW 19 8782631 missense possibly damaging 0.93
R5814:Taf6l UTSW 19 8774846 missense probably benign 0.13
R6008:Taf6l UTSW 19 8778166 missense possibly damaging 0.65
R6228:Taf6l UTSW 19 8778666 missense probably benign 0.01
R6569:Taf6l UTSW 19 8772710 missense probably damaging 1.00
R6768:Taf6l UTSW 19 8774549 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGACATGTCAGCTAGGGG -3'
(R):5'- AGCAGATTCTTCGCAAGCTC -3'

Sequencing Primer
(F):5'- CATGTCAGCTAGGGGGCTAAG -3'
(R):5'- ACAGGTAAAATCTGTAAGCCACG -3'
Posted On2017-08-16