Mutagenetix > Incidental Mutation

Incidental Mutation 'R6091:Sorcs1'

485955

Institutional Source

Beutler Lab

Gene Symbol

Sorcs1

Ensembl Gene

ENSMUSG00000043531

Gene Name

sortilin-related VPS10 domain containing receptor 1

Synonyms

MMRRC Submission

044248-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R6091 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

50131737-50667084 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 50276539 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 338 (T338A)

Ref Sequence

ENSEMBL: ENSMUSP00000147456 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072685] [ENSMUST00000111756] [ENSMUST00000164039] [ENSMUST00000209413] [ENSMUST00000209783] [ENSMUST00000211008] [ENSMUST00000211687]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000072685
AA Change: T338A

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000072472
Gene: ENSMUSG00000043531
AA Change: T338A

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	94	113	N/A	INTRINSIC
VPS10	196	797	N/A	SMART
PKD	799	889	3.84e-1	SMART
PKD	897	975	8.63e-1	SMART
transmembrane domain	1098	1120	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111756
AA Change: T338A

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000107386
Gene: ENSMUSG00000043531
AA Change: T338A

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	94	113	N/A	INTRINSIC
VPS10	196	797	N/A	SMART
PKD	799	889	3.84e-1	SMART
PKD	897	975	8.63e-1	SMART
transmembrane domain	1098	1120	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000164039
AA Change: T338A

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000132615
Gene: ENSMUSG00000043531
AA Change: T338A

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	94	113	N/A	INTRINSIC
VPS10	196	797	N/A	SMART
PKD	799	889	3.84e-1	SMART
PKD	897	975	8.63e-1	SMART
transmembrane domain	1098	1120	N/A	INTRINSIC
low complexity region	1129	1142	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000209413
AA Change: T338A

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

probably benign
Transcript: ENSMUST00000209783
AA Change: T338A

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211008
AA Change: T338A

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)

Predicted Effect

probably benign
Transcript: ENSMUST00000211687
AA Change: T338A

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)

Meta Mutation Damage Score

0.0593

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.8%

Validation Efficiency

96% (54/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. Two of the five family members (sortilin and sortilin-related receptor) are synthesized as preproproteins; it is not yet known if this encoded protein is also a preproprotein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null allele have abnormal amyloid beta levels in the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930568D16Rik	T	G	2: 35,252,348 (GRCm39)	T50P	possibly damaging	Het
Adad1	A	G	3: 37,139,118 (GRCm39)	E396G	possibly damaging	Het
Adamtsl3	T	A	7: 82,114,829 (GRCm39)	C232S	probably damaging	Het
AI606181	T	C	19: 41,582,063 (GRCm39)	S78P	unknown	Het
Amph	T	A	13: 19,309,293 (GRCm39)	M457K	probably benign	Het
Ano1	A	T	7: 144,223,171 (GRCm39)	M174K	probably benign	Het
C3	T	A	17: 57,528,967 (GRCm39)	K632*	probably null	Het
Cep170	C	T	1: 176,583,397 (GRCm39)	G994D	probably damaging	Het
Chd7	T	C	4: 8,751,875 (GRCm39)	V124A	probably damaging	Het
Chd9	A	G	8: 91,761,691 (GRCm39)	K2259E	probably damaging	Het
Col7a1	A	G	9: 108,784,402 (GRCm39)	T137A	unknown	Het
Dcc	C	T	18: 71,942,185 (GRCm39)	V311I	probably benign	Het
Ddx42	A	T	11: 106,125,796 (GRCm39)	Q282L	probably damaging	Het
Fcgbp	A	G	7: 27,804,390 (GRCm39)	T1833A	possibly damaging	Het
Fpr-rs3	A	G	17: 20,844,532 (GRCm39)	I203T	probably benign	Het
Frem1	A	G	4: 82,818,796 (GRCm39)	I2139T	probably benign	Het
Frmpd2	T	C	14: 33,244,820 (GRCm39)	V546A	probably damaging	Het
Gbp11	G	T	5: 105,479,254 (GRCm39)	T123N	possibly damaging	Het
Hs3st1	G	A	5: 39,772,007 (GRCm39)	P212L	probably damaging	Het
Ifnb1	T	A	4: 88,440,813 (GRCm39)	M67L	probably benign	Het
Ighv1-54	T	C	12: 115,157,497 (GRCm39)	N50S	probably benign	Het
Ikzf4	G	A	10: 128,470,542 (GRCm39)	T326I	probably benign	Het
Ints2	A	T	11: 86,127,429 (GRCm39)	V501E	probably damaging	Het
Mfsd1	C	A	3: 67,507,270 (GRCm39)		probably null	Het
Mroh2a	GCCC	GC	1: 88,159,979 (GRCm39)		probably null	Het
Mrps11	G	A	7: 78,438,466 (GRCm39)	A73T	possibly damaging	Het
Mterf4	T	C	1: 93,229,291 (GRCm39)	E311G	probably damaging	Het
Mx2	A	G	16: 97,347,635 (GRCm39)	T176A	probably damaging	Het
Mycbp2	A	C	14: 103,460,482 (GRCm39)	L1495R	probably damaging	Het
Myo3b	A	G	2: 70,069,113 (GRCm39)	T451A	probably benign	Het
Myrfl	T	C	10: 116,685,111 (GRCm39)	T90A	probably benign	Het
Nbeal1	A	G	1: 60,220,715 (GRCm39)		probably benign	Het
Ncor1	A	G	11: 62,310,443 (GRCm39)	L201P	probably damaging	Het
Nfxl1	G	T	5: 72,671,533 (GRCm39)	L909I	probably benign	Het
Nr3c1	GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC	GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC	18: 39,620,011 (GRCm39)		probably benign	Het
Or5aq1b	T	A	2: 86,901,705 (GRCm39)	S258C	probably benign	Het
Plscr5	A	G	9: 92,086,437 (GRCm39)	T136A	probably benign	Het
Ppp1r3a	G	A	6: 14,719,339 (GRCm39)	T525I	probably benign	Het
Ptprg	G	A	14: 12,215,979 (GRCm38)	G1143R	probably damaging	Het
Rbm47	G	C	5: 66,183,626 (GRCm39)	R326G	probably damaging	Het
Ryr1	T	C	7: 28,771,398 (GRCm39)	T2541A	probably benign	Het
Sall1	A	G	8: 89,755,247 (GRCm39)	L1244P	probably damaging	Het
Sec16a	G	A	2: 26,316,482 (GRCm39)	H1673Y	probably damaging	Het
Slc22a19	A	G	19: 7,688,428 (GRCm39)	I44T	probably benign	Het
Snap91	T	A	9: 86,721,681 (GRCm39)	N53Y	probably damaging	Het
Taf6l	T	C	19: 8,755,920 (GRCm39)	T243A	probably benign	Het
Tex10	T	C	4: 48,459,891 (GRCm39)	R487G	probably damaging	Het
Tfcp2	G	T	15: 100,410,194 (GRCm39)	T391N	probably damaging	Het
Tnxb	G	A	17: 34,929,338 (GRCm39)	V2794M	probably damaging	Het
Ush2a	T	G	1: 188,132,000 (GRCm39)	C741G	probably damaging	Het
Vmn1r3	T	A	4: 3,184,684 (GRCm39)	I208F	probably damaging	Het
Vmn2r28	T	A	7: 5,496,790 (GRCm39)	I21F	possibly damaging	Het
Vmn2r93	A	G	17: 18,545,958 (GRCm39)	D610G	probably benign	Het
Wbp1	T	C	6: 83,096,468 (GRCm39)	S229G	probably benign	Het
Xirp1	A	G	9: 119,847,029 (GRCm39)	V618A	probably benign	Het
Zbtb32	A	G	7: 30,291,254 (GRCm39)	S14P	possibly damaging	Het
Zfp24	A	G	18: 24,147,269 (GRCm39)	S348P	probably damaging	Het

Other mutations in Sorcs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Sorcs1	APN	19	50,178,492 (GRCm39)	missense	probably damaging	1.00
IGL00983:Sorcs1	APN	19	50,164,566 (GRCm39)	missense	probably damaging	0.98
IGL01125:Sorcs1	APN	19	50,216,639 (GRCm39)	missense	probably damaging	1.00
IGL01320:Sorcs1	APN	19	50,276,517 (GRCm39)	splice site	probably benign
IGL01445:Sorcs1	APN	19	50,141,504 (GRCm39)	missense	probably damaging	1.00
IGL01682:Sorcs1	APN	19	50,169,944 (GRCm39)	missense	probably benign	0.43
IGL01799:Sorcs1	APN	19	50,218,647 (GRCm39)	critical splice donor site	probably null
IGL02044:Sorcs1	APN	19	50,276,597 (GRCm39)	splice site	probably benign
IGL02111:Sorcs1	APN	19	50,218,683 (GRCm39)	missense	probably benign	0.00
IGL02364:Sorcs1	APN	19	50,322,036 (GRCm39)	missense	probably damaging	1.00
IGL02378:Sorcs1	APN	19	50,171,109 (GRCm39)	nonsense	probably null
IGL02498:Sorcs1	APN	19	50,666,606 (GRCm39)	missense	probably benign
IGL02658:Sorcs1	APN	19	50,178,530 (GRCm39)	missense	probably damaging	1.00
IGL02939:Sorcs1	APN	19	50,666,368 (GRCm39)	nonsense	probably null
IGL02942:Sorcs1	APN	19	50,463,875 (GRCm39)	missense	probably damaging	1.00
IGL03057:Sorcs1	APN	19	50,248,194 (GRCm39)	nonsense	probably null
IGL03230:Sorcs1	APN	19	50,230,531 (GRCm39)	missense	probably damaging	1.00
P0033:Sorcs1	UTSW	19	50,141,345 (GRCm39)	missense	probably damaging	0.98
R0109:Sorcs1	UTSW	19	50,367,329 (GRCm39)	splice site	probably benign
R0115:Sorcs1	UTSW	19	50,624,891 (GRCm39)	intron	probably benign
R0242:Sorcs1	UTSW	19	50,216,659 (GRCm39)	missense	probably damaging	1.00
R0242:Sorcs1	UTSW	19	50,216,659 (GRCm39)	missense	probably damaging	1.00
R0325:Sorcs1	UTSW	19	50,301,480 (GRCm39)	splice site	probably null
R0481:Sorcs1	UTSW	19	50,624,891 (GRCm39)	intron	probably benign
R0581:Sorcs1	UTSW	19	50,241,139 (GRCm39)	missense	possibly damaging	0.70
R0669:Sorcs1	UTSW	19	50,230,380 (GRCm39)	splice site	probably benign
R0980:Sorcs1	UTSW	19	50,220,761 (GRCm39)	missense	probably benign	0.04
R1158:Sorcs1	UTSW	19	50,132,598 (GRCm39)	unclassified	probably benign
R1519:Sorcs1	UTSW	19	50,241,025 (GRCm39)	missense	probably benign	0.05
R1669:Sorcs1	UTSW	19	50,463,860 (GRCm39)	missense	probably damaging	0.99
R1779:Sorcs1	UTSW	19	50,163,481 (GRCm39)	splice site	probably benign
R1783:Sorcs1	UTSW	19	50,216,747 (GRCm39)	critical splice acceptor site	probably null
R1927:Sorcs1	UTSW	19	50,210,633 (GRCm39)	missense	probably damaging	1.00
R1935:Sorcs1	UTSW	19	50,221,082 (GRCm39)	missense	probably damaging	0.96
R1936:Sorcs1	UTSW	19	50,221,082 (GRCm39)	missense	probably damaging	0.96
R2109:Sorcs1	UTSW	19	50,666,630 (GRCm39)	missense	probably benign
R2206:Sorcs1	UTSW	19	50,218,655 (GRCm39)	missense	possibly damaging	0.81
R2207:Sorcs1	UTSW	19	50,218,655 (GRCm39)	missense	possibly damaging	0.81
R3031:Sorcs1	UTSW	19	50,213,613 (GRCm39)	missense	probably damaging	0.98
R3032:Sorcs1	UTSW	19	50,213,613 (GRCm39)	missense	probably damaging	0.98
R3107:Sorcs1	UTSW	19	50,199,088 (GRCm39)	missense	possibly damaging	0.83
R3508:Sorcs1	UTSW	19	50,213,613 (GRCm39)	missense	probably damaging	0.98
R3738:Sorcs1	UTSW	19	50,139,659 (GRCm39)	missense	probably benign	0.03
R4127:Sorcs1	UTSW	19	50,210,597 (GRCm39)	missense	probably benign	0.29
R4212:Sorcs1	UTSW	19	50,213,613 (GRCm39)	missense	probably damaging	0.98
R4213:Sorcs1	UTSW	19	50,213,613 (GRCm39)	missense	probably damaging	0.98
R4385:Sorcs1	UTSW	19	50,178,599 (GRCm39)	missense	probably benign	0.01
R4424:Sorcs1	UTSW	19	50,367,379 (GRCm39)	missense	probably damaging	0.97
R4603:Sorcs1	UTSW	19	50,301,402 (GRCm39)	critical splice donor site	probably null
R4679:Sorcs1	UTSW	19	50,171,107 (GRCm39)	missense	probably benign
R4780:Sorcs1	UTSW	19	50,132,419 (GRCm39)	unclassified	probably benign
R4781:Sorcs1	UTSW	19	50,171,119 (GRCm39)	missense	probably damaging	1.00
R4823:Sorcs1	UTSW	19	50,218,740 (GRCm39)	missense	possibly damaging	0.87
R4823:Sorcs1	UTSW	19	50,666,578 (GRCm39)	missense	possibly damaging	0.92
R4883:Sorcs1	UTSW	19	50,220,741 (GRCm39)	missense	probably benign	0.00
R5091:Sorcs1	UTSW	19	50,248,190 (GRCm39)	critical splice donor site	probably null
R5105:Sorcs1	UTSW	19	50,213,579 (GRCm39)	missense	possibly damaging	0.57
R5437:Sorcs1	UTSW	19	50,241,040 (GRCm39)	missense	probably benign	0.19
R5574:Sorcs1	UTSW	19	50,210,571 (GRCm39)	missense	probably damaging	1.00
R5734:Sorcs1	UTSW	19	50,171,213 (GRCm39)	missense	probably benign	0.04
R6045:Sorcs1	UTSW	19	50,178,555 (GRCm39)	nonsense	probably null
R6119:Sorcs1	UTSW	19	50,276,532 (GRCm39)	missense	probably damaging	0.98
R6226:Sorcs1	UTSW	19	50,169,852 (GRCm39)	missense	probably damaging	1.00
R6337:Sorcs1	UTSW	19	50,132,562 (GRCm39)	missense	probably benign	0.00
R6378:Sorcs1	UTSW	19	50,213,615 (GRCm39)	missense	possibly damaging	0.57
R6782:Sorcs1	UTSW	19	50,164,560 (GRCm39)	nonsense	probably null
R6792:Sorcs1	UTSW	19	50,666,606 (GRCm39)	missense	probably benign
R6891:Sorcs1	UTSW	19	50,213,557 (GRCm39)	nonsense	probably null
R7151:Sorcs1	UTSW	19	50,301,420 (GRCm39)	missense	probably damaging	1.00
R7223:Sorcs1	UTSW	19	50,178,480 (GRCm39)	missense	probably benign	0.06
R7356:Sorcs1	UTSW	19	50,163,595 (GRCm39)	missense	possibly damaging	0.86
R7471:Sorcs1	UTSW	19	50,250,701 (GRCm39)	missense	probably damaging	1.00
R7474:Sorcs1	UTSW	19	50,141,550 (GRCm39)	missense	possibly damaging	0.65
R7503:Sorcs1	UTSW	19	50,141,490 (GRCm39)	missense	probably benign
R7506:Sorcs1	UTSW	19	50,171,112 (GRCm39)	nonsense	probably null
R7573:Sorcs1	UTSW	19	50,141,234 (GRCm39)	nonsense	probably null
R7867:Sorcs1	UTSW	19	50,218,698 (GRCm39)	nonsense	probably null
R7911:Sorcs1	UTSW	19	50,132,470 (GRCm39)	missense	unknown
R8032:Sorcs1	UTSW	19	50,463,846 (GRCm39)	missense	probably benign	0.28
R8063:Sorcs1	UTSW	19	50,132,415 (GRCm39)	missense	unknown
R8463:Sorcs1	UTSW	19	50,248,248 (GRCm39)	missense	probably damaging	1.00
R8682:Sorcs1	UTSW	19	50,367,398 (GRCm39)	missense	probably damaging	0.99
R8724:Sorcs1	UTSW	19	50,139,658 (GRCm39)	missense	probably benign	0.33
R8926:Sorcs1	UTSW	19	50,241,096 (GRCm39)	missense	possibly damaging	0.94
R9160:Sorcs1	UTSW	19	50,213,658 (GRCm39)	missense	probably damaging	1.00
R9173:Sorcs1	UTSW	19	50,220,753 (GRCm39)	missense	possibly damaging	0.92
R9203:Sorcs1	UTSW	19	50,250,733 (GRCm39)	missense	probably damaging	1.00
R9229:Sorcs1	UTSW	19	50,141,300 (GRCm39)	missense	probably benign	0.17
R9398:Sorcs1	UTSW	19	50,213,651 (GRCm39)	missense	possibly damaging	0.90
R9430:Sorcs1	UTSW	19	50,199,208 (GRCm39)	missense	probably damaging	1.00
R9510:Sorcs1	UTSW	19	50,666,521 (GRCm39)	missense	probably benign	0.04
R9511:Sorcs1	UTSW	19	50,666,521 (GRCm39)	missense	probably benign	0.04
R9744:Sorcs1	UTSW	19	50,215,275 (GRCm39)	missense	probably damaging	1.00
R9777:Sorcs1	UTSW	19	50,248,190 (GRCm39)	critical splice donor site	probably null
X0024:Sorcs1	UTSW	19	50,171,201 (GRCm39)	missense	possibly damaging	0.92
Z1088:Sorcs1	UTSW	19	50,210,581 (GRCm39)	missense	probably benign	0.16
Z1177:Sorcs1	UTSW	19	50,322,037 (GRCm39)	missense	probably damaging	1.00
Z1177:Sorcs1	UTSW	19	50,215,180 (GRCm39)	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- AGCGTGGTTCCTCTATTGC -3'
(R):5'- CGTTCCCAGGATTATGGTCTC -3'

Sequencing Primer
(F):5'- ACAGAGGTAGACTTATAAATCTGTGG -3'
(R):5'- ATGGTCTCTGAAACCTGCAG -3'

Posted On

2017-08-16