Incidental Mutation 'R6092:Mavs'
ID485966
Institutional Source Beutler Lab
Gene Symbol Mavs
Ensembl Gene ENSMUSG00000037523
Gene Namemitochondrial antiviral signaling protein
SynonymsIPS-1, D430028G21Rik
MMRRC Submission
Accession Numbers

MGI: 2444773

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6092 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location131234063-131248025 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 131245598 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 339 (R339*)
Ref Sequence ENSEMBL: ENSMUSP00000105828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041362] [ENSMUST00000110199] [ENSMUST00000130597]
PDB Structure
Crystal structure of TRAF3/Cardif [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000041362
AA Change: R339*
SMART Domains Protein: ENSMUSP00000038339
Gene: ENSMUSG00000037523
AA Change: R339*

DomainStartEndE-ValueType
PDB:3J6C|A 1 93 6e-41 PDB
PDB:4GHU|B 138 158 6e-6 PDB
low complexity region 244 265 N/A INTRINSIC
low complexity region 276 296 N/A INTRINSIC
transmembrane domain 479 496 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110199
AA Change: R339*
SMART Domains Protein: ENSMUSP00000105828
Gene: ENSMUSG00000037523
AA Change: R339*

DomainStartEndE-ValueType
Pfam:CARD_2 4 92 1.9e-22 PFAM
PDB:4GHU|B 138 158 6e-6 PDB
low complexity region 244 265 N/A INTRINSIC
low complexity region 276 296 N/A INTRINSIC
transmembrane domain 479 496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130597
SMART Domains Protein: ENSMUSP00000138401
Gene: ENSMUSG00000037523

DomainStartEndE-ValueType
PDB:3J6C|A 1 52 8e-16 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132694
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intermediary protein necessary in the virus-triggered beta interferon signaling pathways. It is required for activation of transcription factors which regulate expression of beta interferon and contributes to antiviral immunity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous and heterozygous mice for mutations display defective innate immunity in response to viral infections. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(5) Gene trapped(6)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,940 P1297S probably benign Het
4930486L24Rik C T 13: 60,853,647 V89M probably benign Het
Abhd16a T C 17: 35,098,810 probably benign Het
Abtb1 A C 6: 88,838,451 C264G probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arid1a C T 4: 133,693,852 G881R unknown Het
Asb8 A G 15: 98,136,242 V144A possibly damaging Het
Atm A C 9: 53,524,414 C199G probably damaging Het
Atxn1 C A 13: 45,566,812 V536L probably benign Het
Baz1a C T 12: 54,909,083 V1074M possibly damaging Het
BC034090 T A 1: 155,224,913 D535V probably damaging Het
Casp8ap2 C A 4: 32,639,380 H145N probably damaging Het
Ccdc24 T A 4: 117,872,448 K25* probably null Het
Ccdc91 A G 6: 147,535,616 N100S possibly damaging Het
Cdh7 A T 1: 110,098,306 Y424F probably benign Het
Clasp1 T C 1: 118,510,298 S612P probably damaging Het
Cxcl14 T C 13: 56,295,833 M55V possibly damaging Het
Dnah11 T C 12: 117,928,456 T3661A probably benign Het
Dnah14 T A 1: 181,621,833 D574E probably benign Het
Dnah6 C T 6: 73,114,697 V2204M possibly damaging Het
Ercc4 A T 16: 13,125,261 H178L probably benign Het
Far2 T C 6: 148,175,083 F475L probably benign Het
Ggt7 A G 2: 155,518,039 probably benign Het
Gm4131 T A 14: 62,480,915 T81S possibly damaging Het
Gprc6a A G 10: 51,615,077 S859P probably damaging Het
Hmgxb3 C A 18: 61,137,600 G884V possibly damaging Het
Homer1 T A 13: 93,366,437 H229Q probably benign Het
Iars T C 13: 49,708,421 S483P probably damaging Het
Kansl1l C G 1: 66,773,484 E457Q probably damaging Het
Krtap4-9 G A 11: 99,785,655 G134D probably benign Het
Lepr C A 4: 101,792,023 P874T probably damaging Het
Mad2l2 T A 4: 148,143,610 F100L probably damaging Het
Mettl1 G A 10: 127,041,974 probably benign Het
Mfsd8 A G 3: 40,819,596 V493A possibly damaging Het
Mtmr9 C T 14: 63,542,452 V63M possibly damaging Het
Mto1 T C 9: 78,460,849 I425T possibly damaging Het
Olfr332 A T 11: 58,490,074 M227K probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr998 A G 2: 85,590,606 Y22C probably benign Het
Pclo C T 5: 14,677,923 T2265I probably benign Het
Phf2 T C 13: 48,816,057 D608G unknown Het
Plch2 T C 4: 154,984,372 T1266A probably benign Het
Prdm12 A G 2: 31,643,877 N169D probably damaging Het
Rimbp3 A G 16: 17,212,270 Y1186C probably damaging Het
Serpinb3d T C 1: 107,079,259 M240V probably damaging Het
Slc25a38 C T 9: 120,116,592 R74C probably damaging Het
Slc25a39 A T 11: 102,404,893 Y117* probably null Het
Slc26a8 T C 17: 28,648,155 N564S probably damaging Het
Spag4 G A 2: 156,065,776 probably benign Het
Stx1b A G 7: 127,807,863 M74T possibly damaging Het
Tbc1d1 A G 5: 64,349,899 D1153G probably benign Het
Tert T C 13: 73,628,581 F484L probably benign Het
Tet1 A G 10: 62,813,715 V72A probably benign Het
Tnfrsf13c T C 15: 82,223,154 T147A probably damaging Het
Trpa1 A T 1: 14,889,486 Y659N probably damaging Het
Trpm2 A G 10: 77,925,682 F1045L probably benign Het
Ttc13 T C 8: 124,679,033 H529R probably benign Het
Ttn T C 2: 76,715,270 T32570A probably damaging Het
Uba7 A G 9: 107,983,160 T892A possibly damaging Het
Uty A T Y: 1,174,836 M195K probably benign Het
Zfp109 A G 7: 24,229,553 S152P possibly damaging Het
Zfp532 T C 18: 65,644,210 V846A probably damaging Het
Zfp658 A T 7: 43,574,527 H742L possibly damaging Het
Zfp831 C A 2: 174,705,506 P1494Q probably damaging Het
Other mutations in Mavs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Mavs APN 2 131246716 missense probably damaging 1.00
IGL01520:Mavs APN 2 131245343 missense probably benign 0.38
IGL01909:Mavs APN 2 131245521 missense probably benign 0.43
IGL01941:Mavs APN 2 131246605 missense probably damaging 1.00
R0044:Mavs UTSW 2 131242024 missense probably damaging 1.00
R0044:Mavs UTSW 2 131242024 missense probably damaging 1.00
R0045:Mavs UTSW 2 131238831 missense probably damaging 1.00
R0751:Mavs UTSW 2 131246764 missense probably damaging 1.00
R2051:Mavs UTSW 2 131240450 missense possibly damaging 0.94
R2061:Mavs UTSW 2 131240306 splice acceptor site probably benign
R2475:Mavs UTSW 2 131240450 missense probably damaging 1.00
R3883:Mavs UTSW 2 131245298 missense probably benign
R4152:Mavs UTSW 2 131246608 missense probably benign 0.22
R4580:Mavs UTSW 2 131240450 missense probably damaging 1.00
R4619:Mavs UTSW 2 131240450 missense probably damaging 1.00
R4779:Mavs UTSW 2 131240365 missense probably damaging 1.00
R4928:Mavs UTSW 2 131246743 missense probably benign 0.00
R6211:Mavs UTSW 2 131240391 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTGACTACCAGCTCAGTGC -3'
(R):5'- CCTCTTAGAAAACAAGGTGCAAG -3'

Sequencing Primer
(F):5'- AGTGCCTTCTCCCAGATTGG -3'
(R):5'- TCTGTCCCAACACCTTGAAG -3'
Posted OnAug 16, 2017