Incidental Mutation 'R6092:Mfsd8'
ID485970
Institutional Source Beutler Lab
Gene Symbol Mfsd8
Ensembl Gene ENSMUSG00000025759
Gene Namemajor facilitator superfamily domain containing 8
Synonyms2810423E13Rik, Cln7
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6092 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location40818103-40846886 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40819596 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 493 (V493A)
Ref Sequence ENSEMBL: ENSMUSP00000026859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026858] [ENSMUST00000026859] [ENSMUST00000167556] [ENSMUST00000203295] [ENSMUST00000203895] [ENSMUST00000204032] [ENSMUST00000204054]
Predicted Effect probably benign
Transcript: ENSMUST00000026858
SMART Domains Protein: ENSMUSP00000026858
Gene: ENSMUSG00000025758

DomainStartEndE-ValueType
S_TKc 12 265 3.46e-100 SMART
low complexity region 288 312 N/A INTRINSIC
low complexity region 329 341 N/A INTRINSIC
PDB:4G7N|B 554 774 6e-41 PDB
low complexity region 820 831 N/A INTRINSIC
Pfam:POLO_box 849 910 7e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000026859
AA Change: V493A

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000026859
Gene: ENSMUSG00000025759
AA Change: V493A

DomainStartEndE-ValueType
Pfam:Sugar_tr 31 235 3.6e-13 PFAM
Pfam:MFS_1 43 387 4.2e-31 PFAM
transmembrane domain 417 439 N/A INTRINSIC
transmembrane domain 452 474 N/A INTRINSIC
transmembrane domain 484 503 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167556
SMART Domains Protein: ENSMUSP00000126945
Gene: ENSMUSG00000025758

DomainStartEndE-ValueType
S_TKc 12 265 3.46e-100 SMART
low complexity region 288 312 N/A INTRINSIC
low complexity region 329 341 N/A INTRINSIC
PDB:4G7N|B 551 771 6e-41 PDB
low complexity region 817 828 N/A INTRINSIC
Pfam:POLO_box 844 908 1.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203295
SMART Domains Protein: ENSMUSP00000145277
Gene: ENSMUSG00000025758

DomainStartEndE-ValueType
S_TKc 12 265 3.46e-100 SMART
low complexity region 288 312 N/A INTRINSIC
low complexity region 329 341 N/A INTRINSIC
PDB:4G7N|B 554 747 3e-32 PDB
low complexity region 793 804 N/A INTRINSIC
Pfam:POLO_box 822 883 6.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203895
SMART Domains Protein: ENSMUSP00000145455
Gene: ENSMUSG00000025758

DomainStartEndE-ValueType
STYKc 12 143 3.5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204032
SMART Domains Protein: ENSMUSP00000145201
Gene: ENSMUSG00000025758

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
Pfam:POLO_box 81 142 2.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204054
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitous integral membrane protein that contains a transporter domain and a major facilitator superfamily (MFS) domain. Other members of the major facilitator superfamily transport small solutes through chemiosmotic ion gradients. The substrate transported by this protein is unknown. The protein likely localizes to lysosomal membranes. Mutations in this gene are correlated with a variant form of late infantile-onset neuronal ceroid lipofuscinoses (vLINCL). [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit accumulation of autofluorescent material in the brain and peripheral tissues, retinal photoreceptor degeneration, presence of dense lamellar bodies in neurons, and a late-onset reactive gliosis and subtle astrogliosis in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,940 P1297S probably benign Het
4930486L24Rik C T 13: 60,853,647 V89M probably benign Het
Abhd16a T C 17: 35,098,810 probably benign Het
Abtb1 A C 6: 88,838,451 C264G probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arid1a C T 4: 133,693,852 G881R unknown Het
Asb8 A G 15: 98,136,242 V144A possibly damaging Het
Atm A C 9: 53,524,414 C199G probably damaging Het
Atxn1 C A 13: 45,566,812 V536L probably benign Het
Baz1a C T 12: 54,909,083 V1074M possibly damaging Het
BC034090 T A 1: 155,224,913 D535V probably damaging Het
Casp8ap2 C A 4: 32,639,380 H145N probably damaging Het
Ccdc24 T A 4: 117,872,448 K25* probably null Het
Ccdc91 A G 6: 147,535,616 N100S possibly damaging Het
Cdh7 A T 1: 110,098,306 Y424F probably benign Het
Clasp1 T C 1: 118,510,298 S612P probably damaging Het
Cxcl14 T C 13: 56,295,833 M55V possibly damaging Het
Dnah11 T C 12: 117,928,456 T3661A probably benign Het
Dnah14 T A 1: 181,621,833 D574E probably benign Het
Dnah6 C T 6: 73,114,697 V2204M possibly damaging Het
Ercc4 A T 16: 13,125,261 H178L probably benign Het
Far2 T C 6: 148,175,083 F475L probably benign Het
Ggt7 A G 2: 155,518,039 probably benign Het
Gm4131 T A 14: 62,480,915 T81S possibly damaging Het
Gprc6a A G 10: 51,615,077 S859P probably damaging Het
Hmgxb3 C A 18: 61,137,600 G884V possibly damaging Het
Homer1 T A 13: 93,366,437 H229Q probably benign Het
Iars T C 13: 49,708,421 S483P probably damaging Het
Kansl1l C G 1: 66,773,484 E457Q probably damaging Het
Krtap4-9 G A 11: 99,785,655 G134D probably benign Het
Lepr C A 4: 101,792,023 P874T probably damaging Het
Mad2l2 T A 4: 148,143,610 F100L probably damaging Het
Mavs A T 2: 131,245,598 R339* probably null Het
Mettl1 G A 10: 127,041,974 probably benign Het
Mtmr9 C T 14: 63,542,452 V63M possibly damaging Het
Mto1 T C 9: 78,460,849 I425T possibly damaging Het
Olfr332 A T 11: 58,490,074 M227K probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr998 A G 2: 85,590,606 Y22C probably benign Het
Pclo C T 5: 14,677,923 T2265I probably benign Het
Phf2 T C 13: 48,816,057 D608G unknown Het
Plch2 T C 4: 154,984,372 T1266A probably benign Het
Prdm12 A G 2: 31,643,877 N169D probably damaging Het
Rimbp3 A G 16: 17,212,270 Y1186C probably damaging Het
Serpinb3d T C 1: 107,079,259 M240V probably damaging Het
Slc25a38 C T 9: 120,116,592 R74C probably damaging Het
Slc25a39 A T 11: 102,404,893 Y117* probably null Het
Slc26a8 T C 17: 28,648,155 N564S probably damaging Het
Spag4 G A 2: 156,065,776 probably benign Het
Stx1b A G 7: 127,807,863 M74T possibly damaging Het
Tbc1d1 A G 5: 64,349,899 D1153G probably benign Het
Tert T C 13: 73,628,581 F484L probably benign Het
Tet1 A G 10: 62,813,715 V72A probably benign Het
Tnfrsf13c T C 15: 82,223,154 T147A probably damaging Het
Trpa1 A T 1: 14,889,486 Y659N probably damaging Het
Trpm2 A G 10: 77,925,682 F1045L probably benign Het
Ttc13 T C 8: 124,679,033 H529R probably benign Het
Ttn T C 2: 76,715,270 T32570A probably damaging Het
Uba7 A G 9: 107,983,160 T892A possibly damaging Het
Uty A T Y: 1,174,836 M195K probably benign Het
Zfp109 A G 7: 24,229,553 S152P possibly damaging Het
Zfp532 T C 18: 65,644,210 V846A probably damaging Het
Zfp658 A T 7: 43,574,527 H742L possibly damaging Het
Zfp831 C A 2: 174,705,506 P1494Q probably damaging Het
Other mutations in Mfsd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1300:Mfsd8 UTSW 3 40823898 missense probably benign 0.32
R4660:Mfsd8 UTSW 3 40821937 missense probably benign 0.06
R5670:Mfsd8 UTSW 3 40822049 missense probably benign
R6126:Mfsd8 UTSW 3 40832011 critical splice donor site probably benign
R6445:Mfsd8 UTSW 3 40837118 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGACTCCAGTAAAGTATGATATG -3'
(R):5'- GCTGTATTCAGAGACATTTCAGAGAG -3'

Sequencing Primer
(F):5'- TGAAAGCAGTTCACCTTTGATAAGG -3'
(R):5'- TTCAGAGACATTTCAGAGAGTAGAG -3'
Posted OnAug 16, 2017