Incidental Mutation 'R6092:Mfsd8'
ID485970
Institutional Source Beutler Lab
Gene Symbol Mfsd8
Ensembl Gene ENSMUSG00000025759
Gene Namemajor facilitator superfamily domain containing 8
Synonyms2810423E13Rik, Cln7
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6092 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location40818070-40846885 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40819596 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 493 (V493A)
Ref Sequence ENSEMBL: ENSMUSP00000026859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026859] [ENSMUST00000203295] [ENSMUST00000203895] [ENSMUST00000204032] [ENSMUST00000204054]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026859
AA Change: V493A

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000026859
Gene: ENSMUSG00000025759
AA Change: V493A

DomainStartEndE-ValueType
Pfam:Sugar_tr 31 235 3.6e-13 PFAM
Pfam:MFS_1 43 387 4.2e-31 PFAM
transmembrane domain 417 439 N/A INTRINSIC
transmembrane domain 452 474 N/A INTRINSIC
transmembrane domain 484 503 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203295
SMART Domains Protein: ENSMUSP00000145277
Gene: ENSMUSG00000025758

DomainStartEndE-ValueType
S_TKc 12 265 3.46e-100 SMART
low complexity region 288 312 N/A INTRINSIC
low complexity region 329 341 N/A INTRINSIC
PDB:4G7N|B 554 747 3e-32 PDB
low complexity region 793 804 N/A INTRINSIC
Pfam:POLO_box 822 883 6.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203895
SMART Domains Protein: ENSMUSP00000145455
Gene: ENSMUSG00000025758

DomainStartEndE-ValueType
STYKc 12 143 3.5e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204032
SMART Domains Protein: ENSMUSP00000145201
Gene: ENSMUSG00000025758

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
Pfam:POLO_box 81 142 2.5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204054
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 98% (61/62)
MGI Phenotype Mice homozygous for a null allele exhibit accumulation of autofluorescent material in the brain and peripheral tissues, retinal photoreceptor degeneration, presence of dense lamellar bodies in neurons, and a late-onset reactive gliosis and subtle astrogliosis in the brain.
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,940 P1297S probably benign Het
4930486L24Rik C T 13: 60,853,647 V89M probably benign Het
Abhd16a T C 17: 35,098,810 probably null Het
Abtb1 A C 6: 88,838,451 C264G probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arid1a C T 4: 133,693,852 G881R unknown Het
Asb8 A G 15: 98,136,242 V144A possibly damaging Het
Atm A C 9: 53,524,414 C199G probably damaging Het
Atxn1 C A 13: 45,566,812 V536L probably benign Het
Baz1a C T 12: 54,909,083 V1074M possibly damaging Het
BC034090 T A 1: 155,224,913 D535V probably damaging Het
Casp8ap2 C A 4: 32,639,380 H145N probably damaging Het
Ccdc24 T A 4: 117,872,448 K25* probably null Het
Ccdc91 A G 6: 147,535,616 N100S possibly damaging Het
Cdh7 A T 1: 110,098,306 Y424F probably benign Het
Clasp1 T C 1: 118,510,298 S612P probably damaging Het
Cxcl14 T C 13: 56,295,833 M55V possibly damaging Het
Dnah11 T C 12: 117,928,456 T3661A probably benign Het
Dnah14 T A 1: 181,621,833 D574E probably benign Het
Dnah6 C T 6: 73,114,697 V2204M possibly damaging Het
Ercc4 A T 16: 13,125,261 H178L probably benign Het
Far2 T C 6: 148,175,083 F475L probably benign Het
Ggt7 A G 2: 155,518,039 probably null Het
Gm4131 T A 14: 62,480,915 T81S possibly damaging Het
Gprc6a A G 10: 51,615,077 S859P probably damaging Het
Hmgxb3 C A 18: 61,137,600 G884V possibly damaging Het
Homer1 T A 13: 93,366,437 H229Q unknown Het
Iars T C 13: 49,708,421 S483P probably damaging Het
Kansl1l C G 1: 66,773,484 E457Q probably damaging Het
Krtap4-9 G A 11: 99,785,655 G134D unknown Het
Lepr C A 4: 101,792,023 P874T probably damaging Het
Mad2l2 T A 4: 148,143,610 F100L probably damaging Het
Mavs A T 2: 131,245,598 R339* probably null Het
Mettl1 G A 10: 127,041,974 unknown Het
Mtmr9 C T 14: 63,542,452 V63M possibly damaging Het
Mto1 T C 9: 78,460,849 I425T possibly damaging Het
Olfr332 A T 11: 58,490,074 M227K probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr998 A G 2: 85,590,606 Y22C probably benign Het
Pclo C T 5: 14,677,923 T2265I unknown Het
Phf2 T C 13: 48,816,057 D608G unknown Het
Plch2 T C 4: 154,984,372 T1266A probably benign Het
Prdm12 A G 2: 31,643,877 N169D probably damaging Het
Rimbp3 A G 16: 17,212,270 Y1186C probably damaging Het
Serpinb3d T C 1: 107,079,259 M240V probably damaging Het
Slc25a38 C T 9: 120,116,592 R74C probably damaging Het
Slc25a39 A T 11: 102,404,893 Y117* probably null Het
Slc26a8 T C 17: 28,648,155 N564S probably damaging Het
Spag4 G A 2: 156,065,776 unknown Het
Stx1b A G 7: 127,807,863 M74T possibly damaging Het
Tbc1d1 A G 5: 64,349,899 D1153G probably benign Het
Tert T C 13: 73,628,581 F484L probably benign Het
Tet1 A G 10: 62,813,715 V72A probably benign Het
Tnfrsf13c T C 15: 82,223,154 T183A possibly damaging Het
Trpa1 A T 1: 14,889,486 Y659N probably damaging Het
Trpm2 A G 10: 77,925,682 F1045L probably benign Het
Ttc13 T C 8: 124,679,033 H529R probably benign Het
Ttn T C 2: 76,715,270 T32570A probably damaging Het
Uba7 A G 9: 107,983,160 T892A possibly damaging Het
Uty A T Y: 1,174,836 M248K possibly damaging Het
Zfp109 A G 7: 24,229,553 S152P possibly damaging Het
Zfp532 T C 18: 65,644,210 V846A probably damaging Het
Zfp658 A T 7: 43,574,527 H742L possibly damaging Het
Zfp831 C A 2: 174,705,506 P1494Q probably damaging Het
Other mutations in Mfsd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1300:Mfsd8 UTSW 3 40823898 missense probably benign 0.32
R4660:Mfsd8 UTSW 3 40821937 missense probably benign 0.06
R4882:Mfsd8 UTSW 3 40835242 synonymous silent
R5670:Mfsd8 UTSW 3 40822049 missense probably benign
R6126:Mfsd8 UTSW 3 40832011 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGGACTCCAGTAAAGTATGATATG -3'
(R):5'- GCTGTATTCAGAGACATTTCAGAGAG -3'

Sequencing Primer
(F):5'- TGAAAGCAGTTCACCTTTGATAAGG -3'
(R):5'- TTCAGAGACATTTCAGAGAGTAGAG -3'
Posted OnAug 16, 2017