Incidental Mutation 'R6092:Tbc1d1'
ID485979
Institutional Source Beutler Lab
Gene Symbol Tbc1d1
Ensembl Gene ENSMUSG00000029174
Gene NameTBC1 domain family, member 1
SynonymsNob1, Nobq1, 1110062G02Rik
MMRRC Submission 044249-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6092 (G1)
Quality Score168.009
Status Validated
Chromosome5
Chromosomal Location64156305-64351486 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64349899 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1153 (D1153G)
Ref Sequence ENSEMBL: ENSMUSP00000112493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043893] [ENSMUST00000101195] [ENSMUST00000119756] [ENSMUST00000121370]
Predicted Effect probably benign
Transcript: ENSMUST00000043893
AA Change: D1246G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044577
Gene: ENSMUSG00000029174
AA Change: D1246G

DomainStartEndE-ValueType
PTB 16 164 3.29e-9 SMART
PTB 168 378 5.93e-34 SMART
low complexity region 519 540 N/A INTRINSIC
Blast:TBC 541 635 2e-27 BLAST
low complexity region 640 663 N/A INTRINSIC
Pfam:DUF3350 777 832 2.5e-25 PFAM
TBC 884 1104 3.84e-89 SMART
Blast:TBC 1129 1186 5e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000101195
AA Change: D1153G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000098756
Gene: ENSMUSG00000029174
AA Change: D1153G

DomainStartEndE-ValueType
PTB 16 164 3.29e-9 SMART
PTB 168 378 5.93e-34 SMART
low complexity region 519 540 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
Pfam:DUF3350 684 739 4e-29 PFAM
TBC 791 1011 3.84e-89 SMART
Blast:TBC 1036 1093 4e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000119756
AA Change: D1024G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113643
Gene: ENSMUSG00000029174
AA Change: D1024G

DomainStartEndE-ValueType
PTB 39 249 5.93e-34 SMART
low complexity region 390 411 N/A INTRINSIC
low complexity region 427 438 N/A INTRINSIC
Pfam:DUF3350 555 610 2.9e-29 PFAM
TBC 662 882 3.84e-89 SMART
Blast:TBC 907 964 4e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000121370
AA Change: D1153G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112493
Gene: ENSMUSG00000029174
AA Change: D1153G

DomainStartEndE-ValueType
PTB 16 164 3.29e-9 SMART
PTB 168 378 5.93e-34 SMART
low complexity region 519 540 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
Pfam:DUF3350 684 739 4e-29 PFAM
TBC 791 1011 3.84e-89 SMART
Blast:TBC 1036 1093 4e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140960
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TBC1D1 is the founding member of a family of proteins sharing a 180- to 200-amino acid TBC domain presumed to have a role in regulating cell growth and differentiation. These proteins share significant homology with TRE2 (USP6; MIM 604334), yeast Bub2, and CDC16 (MIM 603461) (White et al., 2000 [PubMed 10965142]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozgyous for a targeted mutation that removes exon 4 exhibit no adverse phenotype. Mice homozygous for a gene trap allele exhibit decreased body weight, resistance to diet-induced obesity, increased fat oxidization and decreased glucose uptake in the muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,940 P1297S probably benign Het
4930486L24Rik C T 13: 60,853,647 V89M probably benign Het
Abhd16a T C 17: 35,098,810 probably null Het
Abtb1 A C 6: 88,838,451 C264G probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arid1a C T 4: 133,693,852 G881R unknown Het
Asb8 A G 15: 98,136,242 V144A possibly damaging Het
Atm A C 9: 53,524,414 C199G probably damaging Het
Atxn1 C A 13: 45,566,812 V536L probably benign Het
Baz1a C T 12: 54,909,083 V1074M possibly damaging Het
BC034090 T A 1: 155,224,913 D535V probably damaging Het
Casp8ap2 C A 4: 32,639,380 H145N probably damaging Het
Ccdc24 T A 4: 117,872,448 K25* probably null Het
Ccdc91 A G 6: 147,535,616 N100S possibly damaging Het
Cdh7 A T 1: 110,098,306 Y424F probably benign Het
Clasp1 T C 1: 118,510,298 S612P probably damaging Het
Cxcl14 T C 13: 56,295,833 M55V possibly damaging Het
Dnah11 T C 12: 117,928,456 T3661A probably benign Het
Dnah14 T A 1: 181,621,833 D574E probably benign Het
Dnah6 C T 6: 73,114,697 V2204M possibly damaging Het
Ercc4 A T 16: 13,125,261 H178L probably benign Het
Far2 T C 6: 148,175,083 F475L probably benign Het
Ggt7 A G 2: 155,518,039 probably null Het
Gm4131 T A 14: 62,480,915 T81S possibly damaging Het
Gprc6a A G 10: 51,615,077 S788P probably damaging Het
Hmgxb3 C A 18: 61,137,600 G884V possibly damaging Het
Homer1 T A 13: 93,366,437 probably benign Het
Iars T C 13: 49,708,421 S483P probably damaging Het
Kansl1l C G 1: 66,773,484 E457Q probably damaging Het
Krtap4-9 G A 11: 99,785,655 probably benign Het
Lepr C A 4: 101,792,023 P874T probably damaging Het
Mad2l2 T A 4: 148,143,610 F100L probably damaging Het
Mavs A T 2: 131,245,598 R339* probably null Het
Mettl1 G A 10: 127,041,974 probably benign Het
Mfsd8 A G 3: 40,819,596 V493A possibly damaging Het
Mtmr9 C T 14: 63,542,452 V63M possibly damaging Het
Mto1 T C 9: 78,460,849 I425T possibly damaging Het
Olfr332 A T 11: 58,490,074 M227K probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr998 A G 2: 85,590,606 Y22C probably benign Het
Pclo C T 5: 14,677,923 probably benign Het
Phf2 T C 13: 48,816,057 D608G unknown Het
Plch2 T C 4: 154,984,372 T1266A probably benign Het
Prdm12 A G 2: 31,643,877 N169D probably damaging Het
Rimbp3 A G 16: 17,212,270 Y1186C probably damaging Het
Serpinb3d T C 1: 107,079,259 M240V probably damaging Het
Slc25a38 C T 9: 120,116,592 R74C probably damaging Het
Slc25a39 A T 11: 102,404,893 Y109* probably null Het
Slc26a8 T C 17: 28,648,155 N564S probably damaging Het
Spag4 G A 2: 156,065,776 probably benign Het
Stx1b A G 7: 127,807,863 M74T possibly damaging Het
Tert T C 13: 73,628,581 F484L probably benign Het
Tet1 A G 10: 62,813,715 V72A probably benign Het
Tnfrsf13c T C 15: 82,223,154 T147A probably damaging Het
Trpa1 A T 1: 14,889,486 Y659N probably damaging Het
Trpm2 A G 10: 77,925,682 F1045L probably benign Het
Ttc13 T C 8: 124,679,033 H529R probably benign Het
Ttn T C 2: 76,715,270 T32570A probably damaging Het
Uba7 A G 9: 107,983,160 T892A possibly damaging Het
Uty A T Y: 1,174,836 M195K probably benign Het
Zfp109 A G 7: 24,229,553 S152P possibly damaging Het
Zfp532 T C 18: 65,644,210 V846A probably damaging Het
Zfp658 A T 7: 43,574,527 H742L possibly damaging Het
Zfp831 C A 2: 174,705,506 P1494Q probably damaging Het
Other mutations in Tbc1d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02007:Tbc1d1 APN 5 64256992 missense probably damaging 1.00
IGL02341:Tbc1d1 APN 5 64275407 missense probably damaging 1.00
IGL02353:Tbc1d1 APN 5 64256836 missense probably damaging 1.00
IGL02360:Tbc1d1 APN 5 64256836 missense probably damaging 1.00
IGL02963:Tbc1d1 APN 5 64264366 missense probably damaging 1.00
IGL03003:Tbc1d1 APN 5 64316438 missense probably damaging 1.00
R0035:Tbc1d1 UTSW 5 64256737 missense probably damaging 1.00
R0084:Tbc1d1 UTSW 5 64324454 missense probably damaging 0.96
R0321:Tbc1d1 UTSW 5 64339594 missense probably damaging 1.00
R0559:Tbc1d1 UTSW 5 64173793 missense probably damaging 1.00
R1296:Tbc1d1 UTSW 5 64264432 missense probably damaging 1.00
R1922:Tbc1d1 UTSW 5 64311221 missense probably damaging 1.00
R1928:Tbc1d1 UTSW 5 64345300 missense probably damaging 1.00
R2095:Tbc1d1 UTSW 5 64316501 missense probably benign 0.01
R2107:Tbc1d1 UTSW 5 64284705 missense probably benign 0.19
R2253:Tbc1d1 UTSW 5 64284800 missense probably benign 0.00
R3545:Tbc1d1 UTSW 5 64286007 missense probably damaging 1.00
R3546:Tbc1d1 UTSW 5 64286007 missense probably damaging 1.00
R3547:Tbc1d1 UTSW 5 64286007 missense probably damaging 1.00
R4039:Tbc1d1 UTSW 5 64316428 missense probably damaging 0.99
R4289:Tbc1d1 UTSW 5 64260428 missense probably damaging 1.00
R4380:Tbc1d1 UTSW 5 64333548 missense probably benign 0.29
R4405:Tbc1d1 UTSW 5 64173670 missense possibly damaging 0.93
R4564:Tbc1d1 UTSW 5 64173484 missense probably damaging 1.00
R4722:Tbc1d1 UTSW 5 64263557 missense probably damaging 1.00
R4779:Tbc1d1 UTSW 5 64278046 critical splice donor site probably null
R5256:Tbc1d1 UTSW 5 64282009 missense probably damaging 1.00
R5268:Tbc1d1 UTSW 5 64324567 missense probably damaging 0.99
R5510:Tbc1d1 UTSW 5 64333395 missense probably damaging 1.00
R5547:Tbc1d1 UTSW 5 64324544 missense possibly damaging 0.73
R5620:Tbc1d1 UTSW 5 64173712 missense probably benign 0.44
R5680:Tbc1d1 UTSW 5 64324544 missense possibly damaging 0.73
R5874:Tbc1d1 UTSW 5 64349930 makesense probably null
R6002:Tbc1d1 UTSW 5 64333433 missense probably damaging 1.00
R6058:Tbc1d1 UTSW 5 64278009 missense probably damaging 1.00
R6118:Tbc1d1 UTSW 5 64284037 missense probably damaging 0.98
R6183:Tbc1d1 UTSW 5 64275425 missense probably damaging 1.00
R6447:Tbc1d1 UTSW 5 64333493 missense probably damaging 1.00
R6824:Tbc1d1 UTSW 5 64256902 missense probably benign 0.02
R6913:Tbc1d1 UTSW 5 64311109 missense probably benign 0.26
R7039:Tbc1d1 UTSW 5 64284757 missense probably benign 0.08
R7150:Tbc1d1 UTSW 5 64173484 missense probably damaging 1.00
R7154:Tbc1d1 UTSW 5 64173813 missense possibly damaging 0.56
R7316:Tbc1d1 UTSW 5 64335277 critical splice acceptor site probably null
X0064:Tbc1d1 UTSW 5 64275452 missense probably benign 0.04
Z1088:Tbc1d1 UTSW 5 64275393 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCTTGTGTAATCAGAGGCAGG -3'
(R):5'- CCTCCAATCCCAAGTTCTGAGC -3'

Sequencing Primer
(F):5'- TTGTGTAATCAGAGGCAGGTACACTC -3'
(R):5'- GTTCTGAGCTCAAAAGGATCTGC -3'
Posted On2017-08-16