Incidental Mutation 'R6092:Abtb1'
ID485981
Institutional Source Beutler Lab
Gene Symbol Abtb1
Ensembl Gene ENSMUSG00000030083
Gene Nameankyrin repeat and BTB (POZ) domain containing 1
SynonymsBPOZ, EF1ABP
MMRRC Submission 044249-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R6092 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location88835914-88841984 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 88838451 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 264 (C264G)
Ref Sequence ENSEMBL: ENSMUSP00000032169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032169] [ENSMUST00000038409] [ENSMUST00000061262] [ENSMUST00000145944] [ENSMUST00000203137] [ENSMUST00000203272] [ENSMUST00000203864] [ENSMUST00000204327] [ENSMUST00000204458] [ENSMUST00000204932] [ENSMUST00000205082]
Predicted Effect probably benign
Transcript: ENSMUST00000032169
AA Change: C264G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032169
Gene: ENSMUSG00000030083
AA Change: C264G

DomainStartEndE-ValueType
ANK 1 31 5.03e2 SMART
ANK 35 64 2.81e-4 SMART
BTB 115 212 7.8e-18 SMART
BTB 272 376 4.24e-19 SMART
low complexity region 412 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038409
SMART Domains Protein: ENSMUSP00000040417
Gene: ENSMUSG00000033152

DomainStartEndE-ValueType
coiled coil region 88 125 N/A INTRINSIC
low complexity region 132 152 N/A INTRINSIC
Pfam:CD34_antigen 328 539 9e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061262
SMART Domains Protein: ENSMUSP00000058985
Gene: ENSMUSG00000033152

DomainStartEndE-ValueType
coiled coil region 88 125 N/A INTRINSIC
low complexity region 132 152 N/A INTRINSIC
Pfam:CD34_antigen 328 539 5.4e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141401
Predicted Effect probably benign
Transcript: ENSMUST00000145944
SMART Domains Protein: ENSMUSP00000117954
Gene: ENSMUSG00000033152

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 39 57 N/A INTRINSIC
coiled coil region 152 189 N/A INTRINSIC
low complexity region 196 216 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147542
Predicted Effect probably benign
Transcript: ENSMUST00000203120
Predicted Effect probably benign
Transcript: ENSMUST00000203137
Predicted Effect probably benign
Transcript: ENSMUST00000203272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203514
Predicted Effect probably benign
Transcript: ENSMUST00000203864
Predicted Effect probably benign
Transcript: ENSMUST00000204327
Predicted Effect probably benign
Transcript: ENSMUST00000204458
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204560
Predicted Effect probably benign
Transcript: ENSMUST00000204932
Predicted Effect probably benign
Transcript: ENSMUST00000205082
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with an ankyrin repeat region and two BTB/POZ domains, which are thought to be involved in protein-protein interactions. Expression of this gene is activated by the phosphatase and tensin homolog, a tumor suppressor. Alternate splicing results in three transcript variants. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,940 P1297S probably benign Het
4930486L24Rik C T 13: 60,853,647 V89M probably benign Het
Abhd16a T C 17: 35,098,810 probably null Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arid1a C T 4: 133,693,852 G881R unknown Het
Asb8 A G 15: 98,136,242 V144A possibly damaging Het
Atm A C 9: 53,524,414 C199G probably damaging Het
Atxn1 C A 13: 45,566,812 V536L probably benign Het
Baz1a C T 12: 54,909,083 V1074M possibly damaging Het
BC034090 T A 1: 155,224,913 D535V probably damaging Het
Casp8ap2 C A 4: 32,639,380 H145N probably damaging Het
Ccdc24 T A 4: 117,872,448 K25* probably null Het
Ccdc91 A G 6: 147,535,616 N100S possibly damaging Het
Cdh7 A T 1: 110,098,306 Y424F probably benign Het
Clasp1 T C 1: 118,510,298 S612P probably damaging Het
Cxcl14 T C 13: 56,295,833 M55V possibly damaging Het
Dnah11 T C 12: 117,928,456 T3661A probably benign Het
Dnah14 T A 1: 181,621,833 D574E probably benign Het
Dnah6 C T 6: 73,114,697 V2204M possibly damaging Het
Ercc4 A T 16: 13,125,261 H178L probably benign Het
Far2 T C 6: 148,175,083 F475L probably benign Het
Ggt7 A G 2: 155,518,039 probably null Het
Gm4131 T A 14: 62,480,915 T81S possibly damaging Het
Gprc6a A G 10: 51,615,077 S788P probably damaging Het
Hmgxb3 C A 18: 61,137,600 G884V possibly damaging Het
Homer1 T A 13: 93,366,437 probably benign Het
Iars T C 13: 49,708,421 S483P probably damaging Het
Kansl1l C G 1: 66,773,484 E457Q probably damaging Het
Krtap4-9 G A 11: 99,785,655 probably benign Het
Lepr C A 4: 101,792,023 P874T probably damaging Het
Mad2l2 T A 4: 148,143,610 F100L probably damaging Het
Mavs A T 2: 131,245,598 R339* probably null Het
Mettl1 G A 10: 127,041,974 probably benign Het
Mfsd8 A G 3: 40,819,596 V493A possibly damaging Het
Mtmr9 C T 14: 63,542,452 V63M possibly damaging Het
Mto1 T C 9: 78,460,849 I425T possibly damaging Het
Olfr332 A T 11: 58,490,074 M227K probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr998 A G 2: 85,590,606 Y22C probably benign Het
Pclo C T 5: 14,677,923 probably benign Het
Phf2 T C 13: 48,816,057 D608G unknown Het
Plch2 T C 4: 154,984,372 T1266A probably benign Het
Prdm12 A G 2: 31,643,877 N169D probably damaging Het
Rimbp3 A G 16: 17,212,270 Y1186C probably damaging Het
Serpinb3d T C 1: 107,079,259 M240V probably damaging Het
Slc25a38 C T 9: 120,116,592 R74C probably damaging Het
Slc25a39 A T 11: 102,404,893 Y109* probably null Het
Slc26a8 T C 17: 28,648,155 N564S probably damaging Het
Spag4 G A 2: 156,065,776 probably benign Het
Stx1b A G 7: 127,807,863 M74T possibly damaging Het
Tbc1d1 A G 5: 64,349,899 D1153G probably benign Het
Tert T C 13: 73,628,581 F484L probably benign Het
Tet1 A G 10: 62,813,715 V72A probably benign Het
Tnfrsf13c T C 15: 82,223,154 T147A probably damaging Het
Trpa1 A T 1: 14,889,486 Y659N probably damaging Het
Trpm2 A G 10: 77,925,682 F1045L probably benign Het
Ttc13 T C 8: 124,679,033 H529R probably benign Het
Ttn T C 2: 76,715,270 T32570A probably damaging Het
Uba7 A G 9: 107,983,160 T892A possibly damaging Het
Uty A T Y: 1,174,836 M195K probably benign Het
Zfp109 A G 7: 24,229,553 S152P possibly damaging Het
Zfp532 T C 18: 65,644,210 V846A probably damaging Het
Zfp658 A T 7: 43,574,527 H742L possibly damaging Het
Zfp831 C A 2: 174,705,506 P1494Q probably damaging Het
Other mutations in Abtb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01487:Abtb1 APN 6 88839449 missense probably damaging 0.98
IGL02264:Abtb1 APN 6 88836535 missense probably benign 0.00
IGL02376:Abtb1 APN 6 88838484 splice site probably benign
IGL02702:Abtb1 APN 6 88838138 missense probably benign
IGL03132:Abtb1 APN 6 88838959 missense probably benign 0.01
IGL03266:Abtb1 APN 6 88838934 missense probably damaging 0.97
PIT4243001:Abtb1 UTSW 6 88838726 missense probably benign 0.16
PIT4418001:Abtb1 UTSW 6 88839648 missense possibly damaging 0.78
R0331:Abtb1 UTSW 6 88840702 unclassified probably benign
R0763:Abtb1 UTSW 6 88838279 missense probably damaging 0.96
R1565:Abtb1 UTSW 6 88836554 missense probably benign 0.03
R1796:Abtb1 UTSW 6 88836619 missense possibly damaging 0.68
R1822:Abtb1 UTSW 6 88836554 missense probably benign 0.03
R1824:Abtb1 UTSW 6 88836554 missense probably benign 0.03
R2225:Abtb1 UTSW 6 88836367 missense probably damaging 1.00
R2227:Abtb1 UTSW 6 88836367 missense probably damaging 1.00
R2399:Abtb1 UTSW 6 88838738 missense possibly damaging 0.89
R4394:Abtb1 UTSW 6 88836584 missense probably damaging 0.96
R4625:Abtb1 UTSW 6 88836287 missense probably benign 0.00
R5312:Abtb1 UTSW 6 88838258 missense probably damaging 1.00
R5552:Abtb1 UTSW 6 88836548 missense probably benign 0.04
R6035:Abtb1 UTSW 6 88841806 missense probably damaging 1.00
R6035:Abtb1 UTSW 6 88841806 missense probably damaging 1.00
R6195:Abtb1 UTSW 6 88840736 missense probably benign 0.04
R7257:Abtb1 UTSW 6 88839452 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTCTCTTGAAAGTGGTCATCCAG -3'
(R):5'- TTGAAGGGCATGCCAGCTTG -3'

Sequencing Primer
(F):5'- TAGTCACTGCGGCCACAGAAG -3'
(R):5'- ATGCCAGCTTGGTGGGC -3'
Posted On2017-08-16